Starting /dee2/code/volunteer_pipeline.sh SRR5423528 current disk space = 3091344842752 free memory = 1472743392 SRR5423528 SRAfilesize d8275b3332953bb839c7ac0ca86784ab SRR5423528.sra SRR5423528.sra file validated SRR5423528 is single end SRR5423528 is conventional basespace SRR5423528 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423528_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5535 31.0 31.0 34.0 28.0 34.0 2 31.789 33.0 31.0 34.0 30.0 34.0 3 32.01875 33.0 31.0 34.0 30.0 34.0 4 33.0335 35.0 33.0 37.0 22.0 37.0 5 34.761 37.0 35.0 37.0 32.0 37.0 6 35.2645 37.0 35.0 37.0 32.0 37.0 7 35.55325 37.0 35.0 37.0 33.0 37.0 8 35.6 37.0 35.0 37.0 33.0 37.0 9 37.18225 39.0 37.0 39.0 33.0 39.0 10 37.0775 39.0 37.0 39.0 33.0 39.0 11 37.02775 39.0 37.0 39.0 33.0 39.0 12 37.19775 39.0 37.0 39.0 34.0 39.0 13 37.2495 39.0 37.0 39.0 34.0 39.0 14 38.428 40.0 38.0 41.0 33.0 41.0 15 38.49625 40.0 38.0 41.0 34.0 41.0 16 38.33525 40.0 38.0 41.0 33.0 41.0 17 38.331 40.0 38.0 41.0 33.0 41.0 18 38.276 40.0 38.0 41.0 33.0 41.0 19 38.5305 40.0 38.0 41.0 34.0 41.0 20 38.38875 40.0 38.0 41.0 34.0 41.0 21 38.365 40.0 38.0 41.0 34.0 41.0 22 38.12375 40.0 38.0 41.0 33.0 41.0 23 38.29825 40.0 38.0 41.0 34.0 41.0 24 38.34575 40.0 38.0 41.0 34.0 41.0 25 38.44375 40.0 38.0 41.0 34.0 41.0 26 38.23525 40.0 38.0 41.0 33.0 41.0 27 38.19525 40.0 38.0 41.0 34.0 41.0 28 38.34 40.0 38.0 41.0 34.0 41.0 29 38.24475 40.0 38.0 41.0 34.0 41.0 30 38.208 40.0 38.0 41.0 34.0 41.0 31 38.33475 40.0 38.0 41.0 34.0 41.0 32 38.062 40.0 38.0 41.0 33.0 41.0 33 38.16775 40.0 38.0 41.0 33.0 41.0 34 38.1215 40.0 38.0 41.0 33.0 41.0 35 38.23325 40.0 38.0 41.0 34.0 41.0 36 38.16825 40.0 38.0 41.0 33.0 41.0 37 38.0385 40.0 37.0 41.0 33.0 41.0 38 37.9485 40.0 37.0 41.0 33.0 41.0 39 37.37875 40.0 36.0 41.0 31.0 41.0 40 37.5035 40.0 37.0 41.0 31.0 41.0 41 37.6075 40.0 37.0 41.0 32.0 41.0 42 37.619 40.0 37.0 41.0 32.0 41.0 43 37.35 40.0 36.0 41.0 31.0 41.0 44 37.49975 40.0 36.0 41.0 32.0 41.0 45 37.43625 39.0 36.0 41.0 32.0 41.0 46 37.45225 40.0 36.0 41.0 31.0 41.0 47 37.28025 39.0 36.0 41.0 31.0 41.0 48 37.4025 39.0 36.0 41.0 32.0 41.0 49 37.20825 39.0 36.0 41.0 31.0 41.0 50 37.15975 39.0 35.0 41.0 31.0 41.0 51 36.64475 39.0 35.0 40.0 30.0 41.0 52 36.207 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 1.0 22 4.0 23 3.0 24 6.0 25 5.0 26 18.0 27 20.0 28 26.0 29 43.0 30 75.0 31 98.0 32 113.0 33 136.0 34 194.0 35 241.0 36 334.0 37 462.0 38 844.0 39 1368.0 40 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.64464464464464 14.364364364364365 5.405405405405405 35.585585585585584 2 22.775000000000002 15.825 35.15 26.25 3 19.650000000000002 20.3 27.125 32.925 4 25.124999999999996 26.150000000000002 24.0 24.725 5 25.1 32.6 22.575 19.725 6 19.525000000000002 32.375 22.775000000000002 25.324999999999996 7 16.425 22.05 40.525 21.0 8 18.475 20.3 30.8 30.425 9 20.625 19.6 31.775 28.000000000000004 10 21.224999999999998 34.275 23.225 21.275 11 25.674999999999997 24.425 20.825 29.075 12 24.05 19.75 25.575 30.625000000000004 13 21.9 24.025 27.425 26.650000000000002 14 21.625 24.85 26.950000000000003 26.575 15 22.975 24.825 24.925 27.275 16 21.95 23.95 25.650000000000002 28.449999999999996 17 22.45 24.45 25.724999999999998 27.375 18 23.65 24.099999999999998 25.0 27.250000000000004 19 22.650000000000002 24.925 26.125 26.3 20 22.900000000000002 24.625 26.075 26.400000000000002 21 22.45 24.099999999999998 26.200000000000003 27.250000000000004 22 23.9 24.9 25.75 25.45 23 22.775000000000002 24.7 25.900000000000002 26.625 24 23.1 23.724999999999998 25.1 28.075 25 24.275 24.125 25.474999999999998 26.125 26 22.975 24.05 25.45 27.525 27 21.5 23.9 26.950000000000003 27.650000000000002 28 24.6 24.6 23.799999999999997 27.0 29 23.225 24.075 26.174999999999997 26.525 30 23.275000000000002 23.275000000000002 25.8 27.650000000000002 31 22.5 24.4 25.35 27.750000000000004 32 22.900000000000002 24.025 27.075 26.0 33 21.875 23.974999999999998 26.200000000000003 27.950000000000003 34 21.6 25.624999999999996 26.525 26.25 35 23.925 23.275000000000002 25.074999999999996 27.725 36 23.45 23.599999999999998 24.775 28.175 37 22.85 24.6 25.2 27.35 38 22.8 24.275 25.575 27.35 39 22.3 24.349999999999998 24.775 28.575 40 22.725 23.799999999999997 25.674999999999997 27.800000000000004 41 23.825 25.15 25.45 25.575 42 23.525 24.375 24.95 27.150000000000002 43 23.125 23.674999999999997 26.075 27.125 44 22.425 24.425 26.775 26.375 45 23.275000000000002 22.375 25.074999999999996 29.275000000000002 46 24.375 23.775 24.85 27.0 47 23.724999999999998 23.400000000000002 24.975 27.900000000000002 48 22.275 24.075 25.424999999999997 28.225 49 23.5 24.275 25.6 26.625 50 23.1 24.325 25.1 27.474999999999998 51 22.95 23.425 24.425 29.2 52 23.325000000000003 24.474999999999998 24.7 27.500000000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 4.0 23 5.0 24 6.0 25 7.0 26 7.5 27 8.0 28 15.0 29 22.0 30 23.5 31 25.0 32 41.5 33 58.0 34 56.5 35 55.0 36 74.0 37 93.0 38 107.5 39 141.0 40 160.0 41 182.0 42 204.0 43 221.5 44 239.0 45 272.0 46 305.0 47 335.5 48 366.0 49 362.5 50 359.0 51 385.0 52 411.0 53 399.5 54 388.0 55 368.0 56 348.0 57 296.0 58 244.0 59 234.0 60 224.0 61 172.0 62 120.0 63 95.0 64 66.0 65 62.0 66 50.0 67 38.0 68 26.5 69 15.0 70 14.0 71 13.0 72 15.0 73 17.0 74 15.0 75 13.0 76 6.5 77 0.0 78 2.0 79 4.0 80 2.0 81 0.0 82 1.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.525 #Duplication Level Percentage of deduplicated Percentage of total 1 96.36220884585187 92.05 2 2.904998691442031 5.55 3 0.4710808688824915 1.35 4 0.20936927505888508 0.8 5 0.05234231876472127 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit GACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra Read 200000 spots for SRR5423528.sra Written 200000 spots for SRR5423528.sra SRR ids: ['SRR5423528.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zkxvnv_0 SRR5423528.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423528 file size 703975 SRR5423528 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423528 SRR5423528_1.fastq Input file: SRR5423528_1.fastq trimmed: SRR5423528-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:00:53 2025 >> started Thu Feb 13 13:00:55 2025 >> done (1.849s) 4000000 reads processed; of these: 167 ( 0.00%) short reads filtered out after trimming by size control 146 ( 0.00%) empty reads filtered out after trimming by size control 3999687 (99.99%) reads available; of these: 89376 ( 2.23%) trimmed reads available after processing 3910311 (97.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 6 0.00% 25 10 0.00% 26 28 0.00% 27 22 0.00% 28 35 0.00% 29 41 0.00% 30 45 0.00% 31 73 0.00% 32 91 0.00% 33 84 0.00% 34 74 0.00% 35 62 0.00% 36 103 0.00% 37 134 0.00% 38 187 0.00% 39 151 0.00% 40 245 0.01% 41 347 0.01% 42 313 0.01% 43 494 0.01% 44 603 0.02% 45 898 0.02% 46 1323 0.03% 47 1607 0.04% 48 2291 0.06% 49 4406 0.11% 50 11058 0.28% 51 64623 1.62% 52 3910311 97.77% 3999687 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.31 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=18.91 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 13 13:01:08 Started mapping on | Feb 13 13:01:08 Finished on | Feb 13 13:01:13 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999687 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3238673 Uniquely mapped reads % | 80.97% Average mapped length | 51.83 Number of splices: Total | 401654 Number of splices: Annotated (sjdb) | 397122 Number of splices: GT/AG | 394371 Number of splices: GC/AG | 6713 Number of splices: AT/AC | 206 Number of splices: Non-canonical | 364 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310811 % of reads mapped to multiple loci | 7.77% Number of reads mapped to too many loci | 433580 % of reads mapped to too many loci | 10.84% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 450203 450203 450203 N_multimapping 310811 310811 310811 N_noFeature 285779 3185263 303059 N_ambiguous 52131 31 15981 UnstrandedReadsAssigned:2900763 PositiveStrandReadsAssigned:53379 NegativeStrandReadsAssigned:2919633 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423528 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423528-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,687 reads, 3,323,478 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR5423528.ke.tsv 34699 SRR5423528.se.tsv 87100 total ==> SRR5423528.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 63 9.89667 Potri.005G024800.1.v4.1 1035 936 8 2.57655 Potri.004G059700.1.v4.1 961 862 8 2.79773 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 33.2954 3.52922 Potri.016G087400.1.v4.1 270 171 83 146.321 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 33 11.3303 ==> SRR5423528.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 72 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR5423528 completed mapping pipeline successfully