Starting /dee2/code/volunteer_pipeline.sh SRR5423529 current disk space = 3091322593280 free memory = 1444152996 SRR5423529 SRAfilesize 1e263a92cb4ad03b6a1897d67ef5fb88 SRR5423529.sra SRR5423529.sra file validated SRR5423529 is single end SRR5423529 is conventional basespace SRR5423529 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423529_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.15225 33.0 31.0 34.0 30.0 34.0 2 32.17 34.0 31.0 34.0 30.0 34.0 3 32.30975 34.0 31.0 34.0 30.0 34.0 4 35.5635 37.0 35.0 37.0 33.0 37.0 5 35.802 37.0 35.0 37.0 33.0 37.0 6 35.70375 37.0 35.0 37.0 33.0 37.0 7 35.739 37.0 35.0 37.0 33.0 37.0 8 35.721 37.0 35.0 37.0 33.0 37.0 9 37.5615 39.0 37.0 39.0 35.0 39.0 10 37.3775 39.0 37.0 39.0 35.0 39.0 11 37.59825 39.0 37.0 39.0 35.0 39.0 12 37.5185 39.0 37.0 39.0 35.0 39.0 13 37.4535 39.0 37.0 39.0 34.0 39.0 14 38.89375 40.0 38.0 41.0 35.0 41.0 15 38.796 40.0 38.0 41.0 35.0 41.0 16 38.6725 40.0 38.0 41.0 34.0 41.0 17 38.7495 40.0 38.0 41.0 34.0 41.0 18 38.78475 40.0 38.0 41.0 35.0 41.0 19 38.73075 40.0 38.0 41.0 34.0 41.0 20 38.70175 40.0 38.0 41.0 34.0 41.0 21 38.60175 40.0 38.0 41.0 34.0 41.0 22 38.6155 40.0 38.0 41.0 34.0 41.0 23 38.6545 40.0 38.0 41.0 34.0 41.0 24 38.509 40.0 38.0 41.0 34.0 41.0 25 38.5935 40.0 38.0 41.0 34.0 41.0 26 38.451 40.0 38.0 41.0 34.0 41.0 27 38.48825 40.0 38.0 41.0 34.0 41.0 28 38.29875 40.0 38.0 41.0 34.0 41.0 29 38.32575 40.0 38.0 41.0 34.0 41.0 30 38.32575 40.0 38.0 41.0 33.0 41.0 31 38.415 40.0 38.0 41.0 34.0 41.0 32 38.351 40.0 38.0 41.0 34.0 41.0 33 38.27475 40.0 38.0 41.0 34.0 41.0 34 38.1995 40.0 38.0 41.0 34.0 41.0 35 38.12125 40.0 38.0 41.0 33.0 41.0 36 37.994 40.0 37.0 41.0 33.0 41.0 37 37.858 40.0 37.0 41.0 33.0 41.0 38 37.882 40.0 37.0 41.0 32.0 41.0 39 38.01675 40.0 37.0 41.0 33.0 41.0 40 37.7725 40.0 37.0 41.0 33.0 41.0 41 37.73325 40.0 37.0 41.0 33.0 41.0 42 37.63075 40.0 37.0 41.0 32.0 41.0 43 37.723 40.0 37.0 41.0 33.0 41.0 44 37.62275 40.0 37.0 41.0 32.0 41.0 45 37.4865 40.0 37.0 41.0 32.0 41.0 46 37.44525 40.0 37.0 41.0 31.0 41.0 47 37.4005 40.0 36.0 41.0 32.0 41.0 48 37.27325 39.0 36.0 41.0 31.0 41.0 49 37.24425 39.0 36.0 41.0 31.0 41.0 50 37.31 39.0 36.0 41.0 31.0 41.0 51 37.06725 39.0 36.0 41.0 31.0 41.0 52 35.82775 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1210 1 0.0 1210 2 0.0 1210 3 0.0 1210 4 0.0 1210 5 0.0 1210 6 0.0 1210 7 0.0 1210 8 0.0 1210 9 0.0 1210 10 0.0 1210 11 0.0 1210 12 0.0 1210 13 0.0 1210 14 0.0 1210 15 0.0 1210 16 0.0 1210 17 0.0 1210 18 0.0 1210 19 0.0 1210 20 0.0 1210 21 0.0 1210 22 0.0 1210 23 0.0 1210 24 0.0 1210 25 0.0 1210 26 0.0 1210 27 0.0 1210 28 0.0 1210 29 0.0 1210 30 0.0 1210 31 0.0 1210 32 0.0 1210 33 0.0 1210 34 0.0 1210 35 0.0 1210 36 0.0 1210 37 0.0 1210 38 0.0 1210 39 0.0 1210 40 0.0 1210 41 0.0 1210 42 0.0 1210 43 0.0 1210 44 0.0 1210 45 0.0 1210 46 0.0 1210 47 0.0 1210 48 0.0 1210 49 0.0 1210 50 0.0 1210 51 0.0 1210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 3.0 23 2.0 24 11.0 25 13.0 26 15.0 27 16.0 28 20.0 29 30.0 30 63.0 31 74.0 32 106.0 33 128.0 34 164.0 35 214.0 36 315.0 37 436.0 38 730.0 39 1652.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.864729458917836 13.827655310621243 6.212424849699398 35.09519038076152 2 22.05 16.0 34.525 27.425 3 19.425 20.3 25.474999999999998 34.8 4 24.625 29.349999999999998 21.7 24.325 5 23.849999999999998 32.725 22.675 20.75 6 21.375 30.85 23.75 24.025 7 16.2 20.5 41.55 21.75 8 17.825 19.825 31.624999999999996 30.725 9 18.575 20.150000000000002 32.95 28.325 10 19.75 35.25 23.400000000000002 21.6 11 25.3 24.2 21.025 29.475 12 23.674999999999997 21.175 25.6 29.549999999999997 13 20.25 25.1 29.299999999999997 25.35 14 21.8 24.9 27.125 26.174999999999997 15 21.7 24.85 26.575 26.875 16 21.5 24.9 26.05 27.55 17 23.425 24.025 25.8 26.75 18 22.075 22.875 26.674999999999997 28.375 19 21.725 25.1 25.3 27.875 20 23.674999999999997 24.675 25.124999999999996 26.525 21 22.425 23.925 25.924999999999997 27.725 22 21.5 25.95 26.025 26.525 23 22.900000000000002 23.674999999999997 24.575 28.849999999999998 24 22.400000000000002 23.175 26.224999999999998 28.199999999999996 25 22.825 24.175 25.650000000000002 27.35 26 22.25 23.849999999999998 26.674999999999997 27.224999999999998 27 22.05 24.2 27.125 26.625 28 23.75 24.7 25.224999999999998 26.325 29 23.05 25.424999999999997 25.825 25.7 30 21.65 24.0 26.075 28.275 31 23.3 24.925 25.3 26.474999999999998 32 22.625 24.05 26.950000000000003 26.375 33 22.1 23.325000000000003 25.724999999999998 28.849999999999998 34 23.575 25.0 25.174999999999997 26.25 35 23.65 24.325 26.525 25.5 36 22.5 24.15 24.85 28.499999999999996 37 23.075000000000003 23.549999999999997 25.624999999999996 27.750000000000004 38 23.125 22.475 26.674999999999997 27.725 39 22.875 23.175 25.775 28.175 40 22.575 23.775 24.925 28.725 41 23.5 24.8 25.674999999999997 26.025 42 22.900000000000002 24.05 24.775 28.275 43 23.974999999999998 24.05 25.05 26.924999999999997 44 22.375 24.6 26.85 26.174999999999997 45 23.7 23.25 24.55 28.499999999999996 46 23.025000000000002 24.825 25.025 27.125 47 23.575 24.425 25.674999999999997 26.325 48 22.575 23.150000000000002 25.724999999999998 28.549999999999997 49 22.1 23.625 25.1 29.175 50 22.025 23.775 26.0 28.199999999999996 51 22.225 22.8 26.174999999999997 28.799999999999997 52 24.9 24.0 24.7 26.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 1.5 21 1.0 22 4.0 23 7.0 24 6.5 25 6.0 26 9.0 27 12.0 28 18.0 29 24.0 30 28.5 31 33.0 32 37.0 33 41.0 34 53.5 35 66.0 36 80.0 37 94.0 38 102.5 39 138.5 40 166.0 41 203.5 42 241.0 43 254.0 44 267.0 45 274.0 46 281.0 47 317.0 48 353.0 49 360.5 50 368.0 51 391.0 52 414.0 53 404.5 54 395.0 55 354.5 56 314.0 57 290.5 58 267.0 59 227.5 60 188.0 61 156.5 62 125.0 63 93.0 64 54.5 65 48.0 66 40.5 67 33.0 68 26.0 69 19.0 70 18.0 71 17.0 72 21.5 73 26.0 74 18.0 75 10.0 76 7.0 77 4.0 78 3.0 79 2.0 80 1.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 96.52287581699346 92.30000000000001 2 2.7973856209150325 5.35 3 0.4183006535947713 1.2 4 0.130718954248366 0.5 5 0.10457516339869283 0.5 6 0.026143790849673207 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGC 5 0.125 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCT 5 0.125 No Hit GCCTCCTCAAGCTCAAGCAACACTTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit GGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra Read 200000 spots for SRR5423529.sra Written 200000 spots for SRR5423529.sra SRR ids: ['SRR5423529.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_flcvgetr SRR5423529.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423529 file size 703978 SRR5423529 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423529 SRR5423529_1.fastq Input file: SRR5423529_1.fastq trimmed: SRR5423529-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:02:03 2025 >> started Thu Feb 13 13:02:05 2025 >> done (1.908s) 4000000 reads processed; of these: 151 ( 0.00%) short reads filtered out after trimming by size control 163 ( 0.00%) empty reads filtered out after trimming by size control 3999686 (99.99%) reads available; of these: 77550 ( 1.94%) trimmed reads available after processing 3922136 (98.06%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 4 0.00% 21 1 0.00% 22 0 0.00% 23 3 0.00% 24 5 0.00% 25 7 0.00% 26 7 0.00% 27 10 0.00% 28 28 0.00% 29 27 0.00% 30 28 0.00% 31 41 0.00% 32 71 0.00% 33 70 0.00% 34 46 0.00% 35 56 0.00% 36 71 0.00% 37 123 0.00% 38 118 0.00% 39 95 0.00% 40 131 0.00% 41 252 0.01% 42 228 0.01% 43 263 0.01% 44 396 0.01% 45 691 0.02% 46 1039 0.03% 47 1202 0.03% 48 1805 0.05% 49 3500 0.09% 50 9040 0.23% 51 58181 1.45% 52 3922136 98.06% 3999686 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=1.74 fanout-score-rank=40 prefix-density=0.40 prefix-fanout=1.1 sequence=TCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACTTAACGCGTTAGCTACAGCACTGCACGGGTCGATACGCACAGCGCCCAGTATCCATCGTTTACGGCTAGGACTACTGGGGTATCTAATCCCATTCGCTCCCCTAGCTTTCGTCTCTCAGTGTCAGTGTCGGCCCAGCAGAGTGCTTTCACCGTTGGTGTTCTTTCCGATCTCTACGCATTTCACCGCTCCACCGGAAATTCCCTCTGCCCCTACCGTACTCCAGCTTGGCAGTTTCCACCGCCTGTCCAGGGTTGAGCCCTGGGATTTGACGGCGGACTTAAAAAGCCACCTACAGACGCTTTACGCCCAATCATTCCGGATAACGCTTGCATCCTCTGTATTACCGCGGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=18.06 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 13 13:02:18 Started mapping on | Feb 13 13:02:18 Finished on | Feb 13 13:02:23 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999686 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3236452 Uniquely mapped reads % | 80.92% Average mapped length | 51.83 Number of splices: Total | 400188 Number of splices: Annotated (sjdb) | 395753 Number of splices: GT/AG | 392936 Number of splices: GC/AG | 6685 Number of splices: AT/AC | 169 Number of splices: Non-canonical | 398 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311940 % of reads mapped to multiple loci | 7.80% Number of reads mapped to too many loci | 436437 % of reads mapped to too many loci | 10.91% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.37% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451294 451294 451294 N_multimapping 311940 311940 311940 N_noFeature 286625 3183349 303832 N_ambiguous 52067 32 16153 UnstrandedReadsAssigned:2897760 PositiveStrandReadsAssigned:53071 NegativeStrandReadsAssigned:2916467 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423529 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423529-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,686 reads, 3,323,472 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR5423529.ke.tsv 34699 SRR5423529.se.tsv 87100 total ==> SRR5423529.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 71 11.1554 Potri.005G024800.1.v4.1 1035 936 8 2.577 Potri.004G059700.1.v4.1 961 862 8 2.79823 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 26.4355 2.80258 Potri.016G087400.1.v4.1 270 171 77 135.767 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 29 9.95872 ==> SRR5423529.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5423529 completed mapping pipeline successfully