Starting /dee2/code/volunteer_pipeline.sh SRR5423530 current disk space = 3052028461056 free memory = 1438940836 SRR5423530 SRAfilesize 3aea0e8e1bdeed21667e631eb1fe7699 SRR5423530.sra SRR5423530.sra file validated SRR5423530 is single end SRR5423530 is conventional basespace SRR5423530 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423530_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.27875 34.0 31.0 34.0 30.0 34.0 2 32.389 34.0 31.0 34.0 30.0 34.0 3 32.3465 34.0 31.0 34.0 30.0 34.0 4 35.8895 37.0 35.0 37.0 35.0 37.0 5 35.8425 37.0 35.0 37.0 35.0 37.0 6 35.81175 37.0 35.0 37.0 35.0 37.0 7 35.83775 37.0 35.0 37.0 35.0 37.0 8 35.905 37.0 35.0 37.0 35.0 37.0 9 37.60625 39.0 37.0 39.0 35.0 39.0 10 37.36225 39.0 37.0 39.0 34.0 39.0 11 37.471 39.0 37.0 39.0 34.0 39.0 12 37.4975 39.0 37.0 39.0 35.0 39.0 13 37.49575 39.0 37.0 39.0 35.0 39.0 14 38.81525 40.0 38.0 41.0 35.0 41.0 15 38.69625 40.0 38.0 41.0 34.0 41.0 16 38.73575 40.0 38.0 41.0 35.0 41.0 17 38.7355 40.0 38.0 41.0 35.0 41.0 18 38.75725 40.0 38.0 41.0 35.0 41.0 19 38.83275 40.0 38.0 41.0 35.0 41.0 20 38.677 40.0 38.0 41.0 34.0 41.0 21 38.757 40.0 38.0 41.0 35.0 41.0 22 38.63125 40.0 38.0 41.0 34.0 41.0 23 38.62775 40.0 38.0 41.0 34.0 41.0 24 38.5945 40.0 38.0 41.0 34.0 41.0 25 38.676 40.0 38.0 41.0 34.0 41.0 26 38.5665 40.0 38.0 41.0 34.0 41.0 27 38.49025 40.0 38.0 41.0 34.0 41.0 28 38.47325 40.0 38.0 41.0 34.0 41.0 29 38.49275 40.0 38.0 41.0 34.0 41.0 30 38.4785 40.0 38.0 41.0 34.0 41.0 31 38.29325 40.0 38.0 41.0 34.0 41.0 32 38.3645 40.0 38.0 41.0 34.0 41.0 33 38.3465 40.0 38.0 41.0 34.0 41.0 34 38.30525 40.0 38.0 41.0 34.0 41.0 35 38.27975 40.0 38.0 41.0 34.0 41.0 36 38.05325 40.0 38.0 41.0 33.0 41.0 37 38.08925 40.0 38.0 41.0 33.0 41.0 38 37.9675 40.0 38.0 41.0 33.0 41.0 39 37.94775 40.0 38.0 41.0 33.0 41.0 40 37.8835 40.0 37.0 41.0 33.0 41.0 41 37.58525 40.0 37.0 41.0 32.0 41.0 42 37.57375 40.0 37.0 41.0 32.0 41.0 43 37.4315 40.0 37.0 41.0 31.0 41.0 44 37.4855 40.0 37.0 41.0 31.0 41.0 45 37.3605 40.0 36.0 41.0 31.0 41.0 46 37.177 40.0 36.0 41.0 31.0 41.0 47 37.191 39.0 36.0 41.0 31.0 41.0 48 37.12425 39.0 36.0 41.0 31.0 41.0 49 37.145 39.0 36.0 41.0 31.0 41.0 50 37.01225 39.0 36.0 41.0 31.0 41.0 51 36.99925 39.0 36.0 41.0 31.0 41.0 52 35.622 38.0 34.0 40.0 27.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1306 1 0.0 1306 2 0.0 1306 3 0.0 1306 4 0.0 1306 5 0.0 1306 6 0.0 1306 7 0.0 1306 8 0.0 1306 9 0.0 1306 10 0.0 1306 11 0.0 1306 12 0.0 1306 13 0.0 1306 14 0.0 1306 15 0.0 1306 16 0.0 1306 17 0.0 1306 18 0.0 1306 19 0.0 1306 20 0.0 1306 21 0.0 1306 22 0.0 1306 23 0.0 1306 24 0.0 1306 25 0.0 1306 26 0.0 1306 27 0.0 1306 28 0.0 1306 29 0.0 1306 30 0.0 1306 31 0.0 1306 32 0.0 1306 33 0.0 1306 34 0.0 1306 35 0.0 1306 36 0.0 1306 37 0.0 1306 38 0.0 1306 39 0.0 1306 40 0.0 1306 41 0.0 1306 42 0.0 1306 43 0.0 1306 44 0.0 1306 45 0.0 1306 46 0.0 1306 47 0.0 1306 48 0.0 1306 49 0.0 1306 50 0.0 1306 51 0.0 1306 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 4.0 21 3.0 22 8.0 23 7.0 24 5.0 25 14.0 26 17.0 27 14.0 28 34.0 29 49.0 30 58.0 31 49.0 32 80.0 33 113.0 34 156.0 35 199.0 36 286.0 37 431.0 38 776.0 39 1686.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.45556946182728 13.466833541927409 5.732165206508135 36.34543178973717 2 23.549999999999997 15.6 33.85 27.0 3 18.925 20.45 26.474999999999998 34.150000000000006 4 23.974999999999998 28.349999999999998 22.55 25.124999999999996 5 23.474999999999998 31.35 22.675 22.5 6 20.349999999999998 32.0 23.474999999999998 24.175 7 17.474999999999998 20.424999999999997 41.099999999999994 21.0 8 18.25 20.175 30.0 31.574999999999996 9 19.75 18.375 31.3 30.575000000000003 10 20.3 34.875 23.1 21.725 11 26.55 24.474999999999998 19.575 29.4 12 23.775 20.0 25.3 30.925000000000004 13 22.175 24.975 27.075 25.775 14 21.45 23.9 26.775 27.875 15 21.625 24.224999999999998 25.474999999999998 28.675 16 23.375 24.275 25.15 27.200000000000003 17 22.425 24.575 26.174999999999997 26.825 18 22.575 23.925 25.674999999999997 27.825 19 23.150000000000002 25.55 26.05 25.25 20 23.35 24.5 25.825 26.325 21 22.400000000000002 22.650000000000002 27.175 27.775 22 22.475 23.575 26.1 27.85 23 23.25 24.125 25.825 26.8 24 22.125 24.875 26.174999999999997 26.825 25 23.549999999999997 24.0 25.05 27.400000000000002 26 23.799999999999997 23.65 26.700000000000003 25.85 27 21.125 23.799999999999997 25.650000000000002 29.425 28 23.1 23.425 24.975 28.499999999999996 29 23.200000000000003 23.525 25.650000000000002 27.625 30 21.45 24.175 25.900000000000002 28.475 31 22.2 23.724999999999998 26.05 28.025 32 22.725 23.825 27.474999999999998 25.974999999999998 33 22.125 23.075000000000003 26.525 28.275 34 22.85 25.124999999999996 25.324999999999996 26.700000000000003 35 23.200000000000003 23.75 26.325 26.724999999999998 36 22.425 23.474999999999998 26.200000000000003 27.900000000000002 37 23.35 24.125 24.525 28.000000000000004 38 22.5 23.175 26.950000000000003 27.375 39 23.025000000000002 22.75 24.325 29.9 40 23.799999999999997 23.25 24.6 28.349999999999998 41 22.175 23.95 25.85 28.025 42 22.25 24.825 25.900000000000002 27.025 43 24.025 23.375 25.35 27.250000000000004 44 23.35 23.974999999999998 26.724999999999998 25.95 45 22.900000000000002 23.400000000000002 26.474999999999998 27.224999999999998 46 23.775 24.725 24.95 26.55 47 23.575 23.0 25.6 27.825 48 22.611305652826413 23.111555777888945 25.76288144072036 28.51425712856428 49 24.675 22.8 25.074999999999996 27.450000000000003 50 23.275000000000002 23.25 26.125 27.35 51 23.175 22.0 26.025 28.799999999999997 52 22.675 23.200000000000003 25.424999999999997 28.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.5 19 1.0 20 1.5 21 2.0 22 2.5 23 3.0 24 2.0 25 1.0 26 7.0 27 13.0 28 15.0 29 17.0 30 21.5 31 26.0 32 33.5 33 41.0 34 48.5 35 56.0 36 63.0 37 70.0 38 84.0 39 120.0 40 142.0 41 167.0 42 192.0 43 243.5 44 295.0 45 308.5 46 322.0 47 340.0 48 358.0 49 377.0 50 396.0 51 403.0 52 410.0 53 386.5 54 363.0 55 362.5 56 362.0 57 327.0 58 292.0 59 241.0 60 190.0 61 163.0 62 136.0 63 98.0 64 49.0 65 38.0 66 35.5 67 33.0 68 27.5 69 22.0 70 18.5 71 15.0 72 18.0 73 21.0 74 14.5 75 8.0 76 7.0 77 6.0 78 5.0 79 4.0 80 4.0 81 4.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.05 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 96.01885804085909 91.64999999999999 2 3.3787323205866944 6.45 3 0.41906757464641176 1.2 4 0.18334206390780514 0.7000000000000001 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra Read 200000 spots for SRR5423530.sra Written 200000 spots for SRR5423530.sra SRR ids: ['SRR5423530.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_eariuh2_ SRR5423530.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423530 file size 703974 SRR5423530 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423530 SRR5423530_1.fastq Input file: SRR5423530_1.fastq trimmed: SRR5423530-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:24:55 2025 >> started Wed Feb 12 16:24:57 2025 >> done (1.678s) 4000000 reads processed; of these: 169 ( 0.00%) short reads filtered out after trimming by size control 162 ( 0.00%) empty reads filtered out after trimming by size control 3999669 (99.99%) reads available; of these: 65752 ( 1.64%) trimmed reads available after processing 3933917 (98.36%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 15 0.00% 19 7 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 3 0.00% 24 0 0.00% 25 5 0.00% 26 7 0.00% 27 5 0.00% 28 12 0.00% 29 15 0.00% 30 14 0.00% 31 17 0.00% 32 31 0.00% 33 34 0.00% 34 16 0.00% 35 27 0.00% 36 44 0.00% 37 39 0.00% 38 59 0.00% 39 67 0.00% 40 99 0.00% 41 121 0.00% 42 122 0.00% 43 149 0.00% 44 255 0.01% 45 389 0.01% 46 630 0.02% 47 745 0.02% 48 1215 0.03% 49 2679 0.07% 50 7406 0.19% 51 51518 1.29% 52 3933917 98.36% 3999669 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=16.72 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 12 16:25:08 Started mapping on | Feb 12 16:25:08 Finished on | Feb 12 16:25:14 Mapping speed, Million of reads per hour | 2399.80 Number of input reads | 3999669 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3233921 Uniquely mapped reads % | 80.85% Average mapped length | 51.84 Number of splices: Total | 401141 Number of splices: Annotated (sjdb) | 396658 Number of splices: GT/AG | 393868 Number of splices: GC/AG | 6700 Number of splices: AT/AC | 189 Number of splices: Non-canonical | 384 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310567 % of reads mapped to multiple loci | 7.76% Number of reads mapped to too many loci | 441215 % of reads mapped to too many loci | 11.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 455181 455181 455181 N_multimapping 310567 310567 310567 N_noFeature 288237 3181005 305277 N_ambiguous 51958 34 16068 UnstrandedReadsAssigned:2893726 PositiveStrandReadsAssigned:52882 NegativeStrandReadsAssigned:2912576 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423530 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423530-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,669 reads, 3,322,789 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR5423530.ke.tsv 34699 SRR5423530.se.tsv 87100 total ==> SRR5423530.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 58 9.12339 Potri.005G024800.1.v4.1 1035 936 5 1.61249 Potri.004G059700.1.v4.1 961 862 8 2.80147 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30 3.18416 Potri.016G087400.1.v4.1 270 171 89 157.108 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.180322 Potri.012G127500.1.v4.1 977 878 32 11.0017 ==> SRR5423530.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 58 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423530 completed mapping pipeline successfully