Starting /dee2/code/volunteer_pipeline.sh SRR5423531 current disk space = 3091777687552 free memory = 1402642844 SRR5423531 SRAfilesize 4741ddd4e7057599f9e658ea4ab96329 SRR5423531.sra SRR5423531.sra file validated SRR5423531 is single end SRR5423531 is conventional basespace SRR5423531 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423531_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.595 34.0 31.0 34.0 31.0 34.0 2 32.747 34.0 31.0 34.0 31.0 34.0 3 32.7575 34.0 31.0 34.0 31.0 34.0 4 36.21575 37.0 37.0 37.0 35.0 37.0 5 36.19575 37.0 37.0 37.0 35.0 37.0 6 36.0705 37.0 36.0 37.0 35.0 37.0 7 36.1625 37.0 37.0 37.0 35.0 37.0 8 36.191 37.0 37.0 37.0 35.0 37.0 9 38.00925 39.0 38.0 39.0 35.0 39.0 10 37.861 39.0 38.0 39.0 35.0 39.0 11 37.9235 39.0 38.0 39.0 35.0 39.0 12 37.93825 39.0 38.0 39.0 35.0 39.0 13 37.86925 39.0 38.0 39.0 35.0 39.0 14 39.344 41.0 39.0 41.0 36.0 41.0 15 39.40675 41.0 39.0 41.0 36.0 41.0 16 39.31525 41.0 39.0 41.0 36.0 41.0 17 39.365 41.0 39.0 41.0 36.0 41.0 18 39.38125 41.0 39.0 41.0 36.0 41.0 19 39.358 41.0 39.0 41.0 36.0 41.0 20 39.257 41.0 39.0 41.0 36.0 41.0 21 39.17975 41.0 39.0 41.0 36.0 41.0 22 39.12475 40.0 39.0 41.0 36.0 41.0 23 39.14475 40.0 39.0 41.0 36.0 41.0 24 39.019 40.0 39.0 41.0 36.0 41.0 25 38.994 40.0 39.0 41.0 35.0 41.0 26 38.866 40.0 39.0 41.0 35.0 41.0 27 38.92925 40.0 39.0 41.0 35.0 41.0 28 38.81125 40.0 39.0 41.0 35.0 41.0 29 38.75825 40.0 38.0 41.0 35.0 41.0 30 38.7 40.0 38.0 41.0 35.0 41.0 31 38.6675 40.0 38.0 41.0 35.0 41.0 32 38.58575 40.0 38.0 41.0 35.0 41.0 33 38.56175 40.0 38.0 41.0 35.0 41.0 34 38.49975 40.0 38.0 41.0 34.0 41.0 35 38.43275 40.0 38.0 41.0 34.0 41.0 36 38.45425 40.0 38.0 41.0 34.0 41.0 37 38.3125 40.0 38.0 41.0 34.0 41.0 38 38.17125 40.0 38.0 41.0 33.0 41.0 39 38.05875 40.0 38.0 41.0 33.0 41.0 40 38.02175 40.0 38.0 41.0 33.0 41.0 41 37.99025 40.0 38.0 41.0 33.0 41.0 42 37.80275 40.0 38.0 41.0 32.0 41.0 43 37.588 40.0 37.0 41.0 32.0 41.0 44 37.6 40.0 37.0 41.0 32.0 41.0 45 37.72 40.0 37.0 41.0 33.0 41.0 46 37.58475 40.0 37.0 41.0 32.0 41.0 47 37.4775 40.0 37.0 41.0 32.0 41.0 48 37.416 40.0 37.0 41.0 32.0 41.0 49 37.26325 40.0 37.0 41.0 31.0 41.0 50 37.26625 40.0 36.0 41.0 31.0 41.0 51 37.0145 40.0 36.0 41.0 31.0 41.0 52 35.33375 38.0 34.0 40.0 26.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2101 1 0.0 2101 2 0.0 2101 3 0.0 2101 4 0.0 2101 5 0.0 2101 6 0.0 2101 7 0.0 2101 8 0.0 2101 9 0.0 2101 10 0.0 2101 11 0.0 2101 12 0.0 2101 13 0.0 2101 14 0.0 2101 15 0.0 2101 16 0.0 2101 17 0.0 2101 18 0.0 2101 19 0.0 2101 20 0.0 2101 21 0.0 2101 22 0.0 2101 23 0.0 2101 24 0.0 2101 25 0.0 2101 26 0.0 2101 27 0.0 2101 28 0.0 2101 29 0.0 2101 30 0.0 2101 31 0.0 2101 32 0.0 2101 33 0.0 2101 34 0.0 2101 35 0.0 2101 36 0.0 2101 37 0.0 2101 38 0.0 2101 39 0.0 2101 40 0.0 2101 41 0.0 2101 42 0.0 2101 43 0.0 2101 44 0.0 2101 45 0.0 2101 46 0.0 2101 47 0.0 2101 48 0.0 2101 49 0.0 2101 50 0.0 2101 51 0.0 2101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 1.0 20 4.0 21 3.0 22 3.0 23 3.0 24 12.0 25 7.0 26 18.0 27 17.0 28 24.0 29 29.0 30 54.0 31 51.0 32 73.0 33 88.0 34 115.0 35 147.0 36 238.0 37 355.0 38 777.0 39 1966.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.09414121181772 12.268402603905859 6.359539308963445 35.27791687531297 2 22.125 15.975 35.15 26.75 3 19.125 20.65 26.150000000000002 34.075 4 25.575 29.225 21.375 23.825 5 25.474999999999998 31.65 22.05 20.825 6 21.725 31.225 22.775000000000002 24.275 7 17.275 21.7 40.2 20.825 8 18.6 20.625 28.9 31.874999999999996 9 18.85 19.55 32.2 29.4 10 18.95 36.0 23.150000000000002 21.9 11 25.074999999999996 25.324999999999996 20.5 29.099999999999998 12 23.549999999999997 20.325 24.9 31.225 13 21.925 24.25 27.500000000000004 26.325 14 21.9 24.375 26.35 27.375 15 21.675 22.975 26.85 28.499999999999996 16 22.5 24.975 25.275 27.250000000000004 17 23.674999999999997 23.95 25.174999999999997 27.200000000000003 18 22.625 23.825 24.275 29.275000000000002 19 23.275000000000002 24.25 27.025 25.45 20 21.85 24.775 26.525 26.85 21 23.599999999999998 22.95 26.224999999999998 27.224999999999998 22 23.474999999999998 24.55 24.975 27.0 23 22.825 24.325 25.4 27.450000000000003 24 22.025 25.025 24.6 28.349999999999998 25 23.325000000000003 23.65 25.924999999999997 27.1 26 21.725 24.224999999999998 26.375 27.675 27 23.150000000000002 23.849999999999998 24.45 28.549999999999997 28 23.474999999999998 25.324999999999996 25.074999999999996 26.125 29 21.9 24.775 25.650000000000002 27.675 30 20.875 24.224999999999998 25.4 29.5 31 23.25 24.7 25.6 26.450000000000003 32 24.4 23.025000000000002 25.374999999999996 27.200000000000003 33 23.974999999999998 23.275000000000002 25.95 26.8 34 23.474999999999998 22.975 25.5 28.050000000000004 35 22.975 23.75 26.375 26.900000000000002 36 23.35 23.1 25.025 28.525 37 23.275000000000002 25.174999999999997 24.425 27.125 38 24.275 23.225 25.6 26.900000000000002 39 24.675 22.225 24.825 28.275 40 23.7 23.825 26.224999999999998 26.25 41 23.799999999999997 24.55 25.25 26.400000000000002 42 24.65 23.3 25.4 26.650000000000002 43 23.7 23.375 25.5 27.425 44 22.175 23.375 27.875 26.575 45 22.5 24.625 24.325 28.549999999999997 46 24.075 24.15 26.125 25.650000000000002 47 23.200000000000003 23.775 25.525 27.500000000000004 48 23.974999999999998 23.25 24.425 28.349999999999998 49 23.5 24.55 24.15 27.800000000000004 50 23.65 24.099999999999998 24.775 27.474999999999998 51 23.7 23.25 24.05 28.999999999999996 52 23.375 23.925 24.05 28.65 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 1.0 22 1.0 23 1.0 24 2.5 25 4.0 26 9.5 27 15.0 28 14.5 29 14.0 30 16.5 31 19.0 32 31.0 33 43.0 34 53.0 35 63.0 36 70.0 37 77.0 38 86.5 39 121.0 40 146.0 41 181.5 42 217.0 43 246.5 44 276.0 45 280.0 46 284.0 47 326.0 48 368.0 49 364.5 50 361.0 51 379.0 52 397.0 53 403.5 54 410.0 55 394.5 56 379.0 57 318.0 58 257.0 59 228.5 60 200.0 61 158.0 62 116.0 63 97.0 64 71.5 65 65.0 66 44.5 67 24.0 68 27.0 69 30.0 70 24.0 71 18.0 72 16.5 73 15.0 74 12.0 75 9.0 76 7.5 77 6.0 78 5.5 79 5.0 80 3.0 81 1.0 82 1.5 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.6 #Duplication Level Percentage of deduplicated Percentage of total 1 95.82452431289641 90.64999999999999 2 3.276955602536998 6.2 3 0.5285412262156448 1.5 4 0.23784355179704017 0.8999999999999999 5 0.026427061310782242 0.125 6 0.07928118393234672 0.44999999999999996 7 0.026427061310782242 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCA 7 0.17500000000000002 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGC 6 0.15 No Hit GCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGG 6 0.15 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCG 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra Read 200000 spots for SRR5423531.sra Written 200000 spots for SRR5423531.sra SRR ids: ['SRR5423531.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_21mn28h9 SRR5423531.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423531 file size 703985 SRR5423531 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423531 SRR5423531_1.fastq Input file: SRR5423531_1.fastq trimmed: SRR5423531-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:38:03 2025 >> started Thu Feb 13 12:38:05 2025 >> done (2.012s) 4000000 reads processed; of these: 151 ( 0.00%) short reads filtered out after trimming by size control 134 ( 0.00%) empty reads filtered out after trimming by size control 3999715 (99.99%) reads available; of these: 68701 ( 1.72%) trimmed reads available after processing 3931014 (98.28%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 6 0.00% 25 10 0.00% 26 12 0.00% 27 14 0.00% 28 28 0.00% 29 32 0.00% 30 23 0.00% 31 51 0.00% 32 52 0.00% 33 62 0.00% 34 47 0.00% 35 46 0.00% 36 55 0.00% 37 98 0.00% 38 104 0.00% 39 92 0.00% 40 171 0.00% 41 220 0.01% 42 211 0.01% 43 267 0.01% 44 390 0.01% 45 703 0.02% 46 1145 0.03% 47 1230 0.03% 48 1722 0.04% 49 3402 0.09% 50 8469 0.21% 51 50019 1.25% 52 3931014 98.28% 3999715 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=17.62 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 13 12:38:19 Started mapping on | Feb 13 12:38:19 Finished on | Feb 13 12:38:25 Mapping speed, Million of reads per hour | 2399.83 Number of input reads | 3999715 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3237191 Uniquely mapped reads % | 80.94% Average mapped length | 51.83 Number of splices: Total | 402271 Number of splices: Annotated (sjdb) | 397714 Number of splices: GT/AG | 395063 Number of splices: GC/AG | 6609 Number of splices: AT/AC | 204 Number of splices: Non-canonical | 395 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 311234 % of reads mapped to multiple loci | 7.78% Number of reads mapped to too many loci | 435701 % of reads mapped to too many loci | 10.89% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.39% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451290 451290 451290 N_multimapping 311234 311234 311234 N_noFeature 286846 3183907 304097 N_ambiguous 52020 28 15975 UnstrandedReadsAssigned:2898325 PositiveStrandReadsAssigned:53256 NegativeStrandReadsAssigned:2917119 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423531 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423531-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,715 reads, 3,315,176 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,039 rounds 52401 SRR5423531.ke.tsv 34699 SRR5423531.se.tsv 87100 total ==> SRR5423531.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 60 9.44214 Potri.005G024800.1.v4.1 1035 936 3 0.96792 Potri.004G059700.1.v4.1 961 862 3 1.05101 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 35.4858 3.76807 Potri.016G087400.1.v4.1 270 171 60 105.962 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 34 11.6944 ==> SRR5423531.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 57 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423531 completed mapping pipeline successfully