Starting /dee2/code/volunteer_pipeline.sh SRR5423532 current disk space = 2796418781184 free memory = 1575039976 SRR5423532_1.fastq is conventional basespace SRR5423532_1.fastq read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423532_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.0 30.0 30.0 30.0 30.0 30.0 2 30.0 30.0 30.0 30.0 30.0 30.0 3 30.0 30.0 30.0 30.0 30.0 30.0 4 30.0 30.0 30.0 30.0 30.0 30.0 5 30.0 30.0 30.0 30.0 30.0 30.0 6 30.0 30.0 30.0 30.0 30.0 30.0 7 30.0 30.0 30.0 30.0 30.0 30.0 8 30.0 30.0 30.0 30.0 30.0 30.0 9 30.0 30.0 30.0 30.0 30.0 30.0 10 30.0 30.0 30.0 30.0 30.0 30.0 11 30.0 30.0 30.0 30.0 30.0 30.0 12 30.0 30.0 30.0 30.0 30.0 30.0 13 30.0 30.0 30.0 30.0 30.0 30.0 14 30.0 30.0 30.0 30.0 30.0 30.0 15 30.0 30.0 30.0 30.0 30.0 30.0 16 30.0 30.0 30.0 30.0 30.0 30.0 17 30.0 30.0 30.0 30.0 30.0 30.0 18 30.0 30.0 30.0 30.0 30.0 30.0 19 30.0 30.0 30.0 30.0 30.0 30.0 20 30.0 30.0 30.0 30.0 30.0 30.0 21 30.0 30.0 30.0 30.0 30.0 30.0 22 30.0 30.0 30.0 30.0 30.0 30.0 23 30.0 30.0 30.0 30.0 30.0 30.0 24 30.0 30.0 30.0 30.0 30.0 30.0 25 30.0 30.0 30.0 30.0 30.0 30.0 26 30.0 30.0 30.0 30.0 30.0 30.0 27 30.0 30.0 30.0 30.0 30.0 30.0 28 30.0 30.0 30.0 30.0 30.0 30.0 29 30.0 30.0 30.0 30.0 30.0 30.0 30 30.0 30.0 30.0 30.0 30.0 30.0 31 30.0 30.0 30.0 30.0 30.0 30.0 32 30.0 30.0 30.0 30.0 30.0 30.0 33 30.0 30.0 30.0 30.0 30.0 30.0 34 30.0 30.0 30.0 30.0 30.0 30.0 35 30.0 30.0 30.0 30.0 30.0 30.0 36 30.0 30.0 30.0 30.0 30.0 30.0 37 30.0 30.0 30.0 30.0 30.0 30.0 38 30.0 30.0 30.0 30.0 30.0 30.0 39 30.0 30.0 30.0 30.0 30.0 30.0 40 30.0 30.0 30.0 30.0 30.0 30.0 41 30.0 30.0 30.0 30.0 30.0 30.0 42 30.0 30.0 30.0 30.0 30.0 30.0 43 30.0 30.0 30.0 30.0 30.0 30.0 44 30.0 30.0 30.0 30.0 30.0 30.0 45 30.0 30.0 30.0 30.0 30.0 30.0 46 30.0 30.0 30.0 30.0 30.0 30.0 47 30.0 30.0 30.0 30.0 30.0 30.0 48 30.0 30.0 30.0 30.0 30.0 30.0 49 30.0 30.0 30.0 30.0 30.0 30.0 50 30.0 30.0 30.0 30.0 30.0 30.0 51 30.0 30.0 30.0 30.0 30.0 30.0 52 30.0 30.0 30.0 30.0 30.0 30.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2114 1 0.0 2114 2 0.0 2114 3 0.0 2114 4 0.0 2114 5 0.0 2114 6 0.0 2114 7 0.0 2114 8 0.0 2114 9 0.0 2114 10 0.0 2114 11 0.0 2114 12 0.0 2114 13 0.0 2114 14 0.0 2114 15 0.0 2114 16 0.0 2114 17 0.0 2114 18 0.0 2114 19 0.0 2114 20 0.0 2114 21 0.0 2114 22 0.0 2114 23 0.0 2114 24 0.0 2114 25 0.0 2114 26 0.0 2114 27 0.0 2114 28 0.0 2114 29 0.0 2114 30 0.0 2114 31 0.0 2114 32 0.0 2114 33 0.0 2114 34 0.0 2114 35 0.0 2114 36 0.0 2114 37 0.0 2114 38 0.0 2114 39 0.0 2114 40 0.0 2114 41 0.0 2114 42 0.0 2114 43 0.0 2114 44 0.0 2114 45 0.0 2114 46 0.0 2114 47 0.0 2114 48 0.0 2114 49 0.0 2114 50 0.0 2114 51 0.0 2114 52 0.0 2115 1 0.0 2115 2 0.0 2115 3 0.0 2115 4 0.0 2115 5 0.0 2115 6 0.0 2115 7 0.0 2115 8 0.0 2115 9 0.0 2115 10 0.0 2115 11 0.0 2115 12 0.0 2115 13 0.0 2115 14 0.0 2115 15 0.0 2115 16 0.0 2115 17 0.0 2115 18 0.0 2115 19 0.0 2115 20 0.0 2115 21 0.0 2115 22 0.0 2115 23 0.0 2115 24 0.0 2115 25 0.0 2115 26 0.0 2115 27 0.0 2115 28 0.0 2115 29 0.0 2115 30 0.0 2115 31 0.0 2115 32 0.0 2115 33 0.0 2115 34 0.0 2115 35 0.0 2115 36 0.0 2115 37 0.0 2115 38 0.0 2115 39 0.0 2115 40 0.0 2115 41 0.0 2115 42 0.0 2115 43 0.0 2115 44 0.0 2115 45 0.0 2115 46 0.0 2115 47 0.0 2115 48 0.0 2115 49 0.0 2115 50 0.0 2115 51 0.0 2115 52 0.0 2116 1 0.0 2116 2 0.0 2116 3 0.0 2116 4 0.0 2116 5 0.0 2116 6 0.0 2116 7 0.0 2116 8 0.0 2116 9 0.0 2116 10 0.0 2116 11 0.0 2116 12 0.0 2116 13 0.0 2116 14 0.0 2116 15 0.0 2116 16 0.0 2116 17 0.0 2116 18 0.0 2116 19 0.0 2116 20 0.0 2116 21 0.0 2116 22 0.0 2116 23 0.0 2116 24 0.0 2116 25 0.0 2116 26 0.0 2116 27 0.0 2116 28 0.0 2116 29 0.0 2116 30 0.0 2116 31 0.0 2116 32 0.0 2116 33 0.0 2116 34 0.0 2116 35 0.0 2116 36 0.0 2116 37 0.0 2116 38 0.0 2116 39 0.0 2116 40 0.0 2116 41 0.0 2116 42 0.0 2116 43 0.0 2116 44 0.0 2116 45 0.0 2116 46 0.0 2116 47 0.0 2116 48 0.0 2116 49 0.0 2116 50 0.0 2116 51 0.0 2116 52 0.0 2201 1 0.0 2201 2 0.0 2201 3 0.0 2201 4 0.0 2201 5 0.0 2201 6 0.0 2201 7 0.0 2201 8 0.0 2201 9 0.0 2201 10 0.0 2201 11 0.0 2201 12 0.0 2201 13 0.0 2201 14 0.0 2201 15 0.0 2201 16 0.0 2201 17 0.0 2201 18 0.0 2201 19 0.0 2201 20 0.0 2201 21 0.0 2201 22 0.0 2201 23 0.0 2201 24 0.0 2201 25 0.0 2201 26 0.0 2201 27 0.0 2201 28 0.0 2201 29 0.0 2201 30 0.0 2201 31 0.0 2201 32 0.0 2201 33 0.0 2201 34 0.0 2201 35 0.0 2201 36 0.0 2201 37 0.0 2201 38 0.0 2201 39 0.0 2201 40 0.0 2201 41 0.0 2201 42 0.0 2201 43 0.0 2201 44 0.0 2201 45 0.0 2201 46 0.0 2201 47 0.0 2201 48 0.0 2201 49 0.0 2201 50 0.0 2201 51 0.0 2201 52 0.0 2202 1 0.0 2202 2 0.0 2202 3 0.0 2202 4 0.0 2202 5 0.0 2202 6 0.0 2202 7 0.0 2202 8 0.0 2202 9 0.0 2202 10 0.0 2202 11 0.0 2202 12 0.0 2202 13 0.0 2202 14 0.0 2202 15 0.0 2202 16 0.0 2202 17 0.0 2202 18 0.0 2202 19 0.0 2202 20 0.0 2202 21 0.0 2202 22 0.0 2202 23 0.0 2202 24 0.0 2202 25 0.0 2202 26 0.0 2202 27 0.0 2202 28 0.0 2202 29 0.0 2202 30 0.0 2202 31 0.0 2202 32 0.0 2202 33 0.0 2202 34 0.0 2202 35 0.0 2202 36 0.0 2202 37 0.0 2202 38 0.0 2202 39 0.0 2202 40 0.0 2202 41 0.0 2202 42 0.0 2202 43 0.0 2202 44 0.0 2202 45 0.0 2202 46 0.0 2202 47 0.0 2202 48 0.0 2202 49 0.0 2202 50 0.0 2202 51 0.0 2202 52 0.0 2203 1 0.0 2203 2 0.0 2203 3 0.0 2203 4 0.0 2203 5 0.0 2203 6 0.0 2203 7 0.0 2203 8 0.0 2203 9 0.0 2203 10 0.0 2203 11 0.0 2203 12 0.0 2203 13 0.0 2203 14 0.0 2203 15 0.0 2203 16 0.0 2203 17 0.0 2203 18 0.0 2203 19 0.0 2203 20 0.0 2203 21 0.0 2203 22 0.0 2203 23 0.0 2203 24 0.0 2203 25 0.0 2203 26 0.0 2203 27 0.0 2203 28 0.0 2203 29 0.0 2203 30 0.0 2203 31 0.0 2203 32 0.0 2203 33 0.0 2203 34 0.0 2203 35 0.0 2203 36 0.0 2203 37 0.0 2203 38 0.0 2203 39 0.0 2203 40 0.0 2203 41 0.0 2203 42 0.0 2203 43 0.0 2203 44 0.0 2203 45 0.0 2203 46 0.0 2203 47 0.0 2203 48 0.0 2203 49 0.0 2203 50 0.0 2203 51 0.0 2203 52 0.0 2204 1 0.0 2204 2 0.0 2204 3 0.0 2204 4 0.0 2204 5 0.0 2204 6 0.0 2204 7 0.0 2204 8 0.0 2204 9 0.0 2204 10 0.0 2204 11 0.0 2204 12 0.0 2204 13 0.0 2204 14 0.0 2204 15 0.0 2204 16 0.0 2204 17 0.0 2204 18 0.0 2204 19 0.0 2204 20 0.0 2204 21 0.0 2204 22 0.0 2204 23 0.0 2204 24 0.0 2204 25 0.0 2204 26 0.0 2204 27 0.0 2204 28 0.0 2204 29 0.0 2204 30 0.0 2204 31 0.0 2204 32 0.0 2204 33 0.0 2204 34 0.0 2204 35 0.0 2204 36 0.0 2204 37 0.0 2204 38 0.0 2204 39 0.0 2204 40 0.0 2204 41 0.0 2204 42 0.0 2204 43 0.0 2204 44 0.0 2204 45 0.0 2204 46 0.0 2204 47 0.0 2204 48 0.0 2204 49 0.0 2204 50 0.0 2204 51 0.0 2204 52 0.0 2205 1 0.0 2205 2 0.0 2205 3 0.0 2205 4 0.0 2205 5 0.0 2205 6 0.0 2205 7 0.0 2205 8 0.0 2205 9 0.0 2205 10 0.0 2205 11 0.0 2205 12 0.0 2205 13 0.0 2205 14 0.0 2205 15 0.0 2205 16 0.0 2205 17 0.0 2205 18 0.0 2205 19 0.0 2205 20 0.0 2205 21 0.0 2205 22 0.0 2205 23 0.0 2205 24 0.0 2205 25 0.0 2205 26 0.0 2205 27 0.0 2205 28 0.0 2205 29 0.0 2205 30 0.0 2205 31 0.0 2205 32 0.0 2205 33 0.0 2205 34 0.0 2205 35 0.0 2205 36 0.0 2205 37 0.0 2205 38 0.0 2205 39 0.0 2205 40 0.0 2205 41 0.0 2205 42 0.0 2205 43 0.0 2205 44 0.0 2205 45 0.0 2205 46 0.0 2205 47 0.0 2205 48 0.0 2205 49 0.0 2205 50 0.0 2205 51 0.0 2205 52 0.0 2206 1 0.0 2206 2 0.0 2206 3 0.0 2206 4 0.0 2206 5 0.0 2206 6 0.0 2206 7 0.0 2206 8 0.0 2206 9 0.0 2206 10 0.0 2206 11 0.0 2206 12 0.0 2206 13 0.0 2206 14 0.0 2206 15 0.0 2206 16 0.0 2206 17 0.0 2206 18 0.0 2206 19 0.0 2206 20 0.0 2206 21 0.0 2206 22 0.0 2206 23 0.0 2206 24 0.0 2206 25 0.0 2206 26 0.0 2206 27 0.0 2206 28 0.0 2206 29 0.0 2206 30 0.0 2206 31 0.0 2206 32 0.0 2206 33 0.0 2206 34 0.0 2206 35 0.0 2206 36 0.0 2206 37 0.0 2206 38 0.0 2206 39 0.0 2206 40 0.0 2206 41 0.0 2206 42 0.0 2206 43 0.0 2206 44 0.0 2206 45 0.0 2206 46 0.0 2206 47 0.0 2206 48 0.0 2206 49 0.0 2206 50 0.0 2206 51 0.0 2206 52 0.0 2207 1 0.0 2207 2 0.0 2207 3 0.0 2207 4 0.0 2207 5 0.0 2207 6 0.0 2207 7 0.0 2207 8 0.0 2207 9 0.0 2207 10 0.0 2207 11 0.0 2207 12 0.0 2207 13 0.0 2207 14 0.0 2207 15 0.0 2207 16 0.0 2207 17 0.0 2207 18 0.0 2207 19 0.0 2207 20 0.0 2207 21 0.0 2207 22 0.0 2207 23 0.0 2207 24 0.0 2207 25 0.0 2207 26 0.0 2207 27 0.0 2207 28 0.0 2207 29 0.0 2207 30 0.0 2207 31 0.0 2207 32 0.0 2207 33 0.0 2207 34 0.0 2207 35 0.0 2207 36 0.0 2207 37 0.0 2207 38 0.0 2207 39 0.0 2207 40 0.0 2207 41 0.0 2207 42 0.0 2207 43 0.0 2207 44 0.0 2207 45 0.0 2207 46 0.0 2207 47 0.0 2207 48 0.0 2207 49 0.0 2207 50 0.0 2207 51 0.0 2207 52 0.0 2208 1 0.0 2208 2 0.0 2208 3 0.0 2208 4 0.0 2208 5 0.0 2208 6 0.0 2208 7 0.0 2208 8 0.0 2208 9 0.0 2208 10 0.0 2208 11 0.0 2208 12 0.0 2208 13 0.0 2208 14 0.0 2208 15 0.0 2208 16 0.0 2208 17 0.0 2208 18 0.0 2208 19 0.0 2208 20 0.0 2208 21 0.0 2208 22 0.0 2208 23 0.0 2208 24 0.0 2208 25 0.0 2208 26 0.0 2208 27 0.0 2208 28 0.0 2208 29 0.0 2208 30 0.0 2208 31 0.0 2208 32 0.0 2208 33 0.0 2208 34 0.0 2208 35 0.0 2208 36 0.0 2208 37 0.0 2208 38 0.0 2208 39 0.0 2208 40 0.0 2208 41 0.0 2208 42 0.0 2208 43 0.0 2208 44 0.0 2208 45 0.0 2208 46 0.0 2208 47 0.0 2208 48 0.0 2208 49 0.0 2208 50 0.0 2208 51 0.0 2208 52 0.0 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 2210 1 0.0 2210 2 0.0 2210 3 0.0 2210 4 0.0 2210 5 0.0 2210 6 0.0 2210 7 0.0 2210 8 0.0 2210 9 0.0 2210 10 0.0 2210 11 0.0 2210 12 0.0 2210 13 0.0 2210 14 0.0 2210 15 0.0 2210 16 0.0 2210 17 0.0 2210 18 0.0 2210 19 0.0 2210 20 0.0 2210 21 0.0 2210 22 0.0 2210 23 0.0 2210 24 0.0 2210 25 0.0 2210 26 0.0 2210 27 0.0 2210 28 0.0 2210 29 0.0 2210 30 0.0 2210 31 0.0 2210 32 0.0 2210 33 0.0 2210 34 0.0 2210 35 0.0 2210 36 0.0 2210 37 0.0 2210 38 0.0 2210 39 0.0 2210 40 0.0 2210 41 0.0 2210 42 0.0 2210 43 0.0 2210 44 0.0 2210 45 0.0 2210 46 0.0 2210 47 0.0 2210 48 0.0 2210 49 0.0 2210 50 0.0 2210 51 0.0 2210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 30 4000000.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.78495216426026 13.108446052611797 5.896901326571012 36.20970045655693 2 22.564149999999998 15.806500000000002 34.61925 27.010099999999998 3 19.654474999999998 20.74485 26.320700000000002 33.279975 4 24.682975 27.678900000000002 23.160175 24.47795 5 24.073900000000002 32.518675 22.6419 20.765525 6 20.594299999999997 31.632074999999997 23.507975000000002 24.26565 7 16.841075 20.746575 41.090325 21.322025 8 18.580125 20.092299999999998 30.0902 31.237375 9 18.991600000000002 19.622700000000002 32.1081 29.2776 10 20.6058 34.62665 23.285875 21.481675 11 25.4423 24.0151 20.167550000000002 30.375049999999998 12 23.33995 20.7425 25.3518 30.56575 13 21.3254 24.746975 27.629399999999997 26.298225 14 21.8021 24.492975 27.1279 26.577025 15 22.211 24.0447 26.195774999999998 27.548525 16 22.883175 24.55805 25.608249999999998 26.950525 17 22.736925 24.32225 26.059225 26.8816 18 22.659950000000002 23.843525 25.7863 27.710225 19 22.958925 24.8723 25.539325 26.62945 20 22.919975 24.5762 26.056175 26.44765 21 22.772228465285583 24.04365505456882 26.0493825617282 27.134733918417396 22 23.054775 24.730774999999998 25.4758 26.738650000000003 23 22.62618484819318 24.425441595405985 25.879822049332684 27.06855150706815 24 22.367275 24.202424999999998 25.862099999999998 27.568199999999997 25 23.2061 24.11 25.532549999999997 27.15135 26 22.675975 23.900850000000002 26.182 27.241175000000002 27 22.025624999999998 24.124925 26.084950000000003 27.764499999999998 28 23.11272334542509 24.28605714542859 25.511591336935023 27.089628172211295 29 22.884127588105205 24.461903621409753 25.713499272737998 26.940469517747047 30 22.16485424586502 23.874576063544527 26.054831406737726 27.905738283852727 31 22.60102812633838 24.601076629939772 25.47326639002946 27.324628853692385 32 23.01025725138467 24.06056038836738 25.95926703057773 26.96991532967022 33 22.605695837126632 23.668086304441918 26.21305768373424 27.51316017469721 34 22.62697633202378 24.438405652149562 25.54984237351875 27.384775642307908 35 23.091652817908688 24.086763270868705 25.74421396099813 27.07736995022448 36 22.742651424714214 24.09787683519066 25.266023737945087 27.89344800215004 37 22.988375 24.447225 24.943199999999997 27.6212 38 23.175974999999998 23.884525 25.552675 27.386824999999998 39 22.622275 23.565025000000002 25.380225 28.432475 40 23.100075 24.648400000000002 25.018849999999997 27.232675 41 23.259925 24.169375000000002 25.464225000000003 27.106475000000003 42 22.990475 23.717025 25.863000000000003 27.4295 43 23.620355905088978 23.955405988851496 25.39100634775159 27.03323175830794 44 23.2125 23.83255 26.305725000000002 26.649224999999998 45 23.157263928601875 23.754656701036854 25.471332772149974 27.616746598211293 46 23.569559344715483 24.086541803417646 25.180816340206263 27.16308251166061 47 23.47478958821694 23.821183986303232 25.603858816093698 27.100167609386126 48 22.834899837652962 23.327166662874486 25.450854953559947 28.38707854591261 49 23.43061574186244 23.653824948673385 25.339083214502622 27.576476094961556 50 23.10135 23.853075 25.594675 27.4509 51 22.718815828750376 23.28079616756359 25.58524305980907 28.415144943876967 52 23.650575 23.54365 25.16985 27.635925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 22.0 1 14.5 2 7.0 3 8.0 4 9.0 5 14.0 6 19.0 7 25.0 8 31.0 9 53.0 10 75.0 11 89.0 12 103.0 13 177.0 14 343.5 15 436.0 16 589.0 17 742.0 18 1035.5 19 1329.0 20 1854.0 21 2379.0 22 3201.5 23 4024.0 24 5140.5 25 6257.0 26 8518.0 27 10779.0 28 15056.5 29 19334.0 30 24138.0 31 28942.0 32 35746.5 33 42551.0 34 52113.0 35 61675.0 36 74933.5 37 88192.0 38 99907.5 39 132288.5 40 152954.0 41 179996.0 42 207038.0 43 235496.5 44 263955.0 45 287695.0 46 311435.0 47 336003.0 48 360571.0 49 371355.0 50 382139.0 51 394402.5 52 406666.0 53 397305.5 54 387945.0 55 364888.5 56 341832.0 57 303476.5 58 265121.0 59 227446.5 60 189772.0 61 158157.0 62 126542.0 63 95891.0 64 58629.0 65 52018.0 66 40858.5 67 29699.0 68 26821.5 69 23944.0 70 20748.5 71 17553.0 72 16728.5 73 15904.0 74 12556.0 75 9208.0 76 6972.5 77 4737.0 78 4374.5 79 4012.0 80 2750.5 81 1489.0 82 1060.5 83 632.0 84 488.5 85 345.0 86 292.0 87 239.0 88 176.0 89 95.5 90 78.0 91 51.5 92 25.0 93 16.0 94 7.0 95 5.0 96 3.0 97 3.0 98 3.0 99 2.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.23149999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.25E-4 22 0.0 23 3.75E-4 24 0.0 25 0.0 26 0.0 27 0.0 28 7.5E-4 29 0.0016500000000000002 30 0.007124999999999999 31 0.007425 32 0.012199999999999999 33 0.015574999999999999 34 0.0168 35 0.006075 36 0.001875 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 2.4999999999999998E-5 44 0.0 45 0.002975 46 0.01595 47 0.0056 48 0.013574999999999999 49 0.015325000000000002 50 0.0 51 9.500000000000001E-4 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000000.0 >>END_MODULE >>Sequence Duplication Levels fail #Total Deduplicated Percentage 40.52462192557284 #Duplication Level Percentage of deduplicated Percentage of total 1 77.87127429972205 31.557039498588125 2 10.665636302656836 8.644417575216657 3 3.830434550159281 4.656807358675696 4 1.9735515828105454 3.1990972697605278 5 1.196666118013105 2.4247221001812003 6 0.7572042764222969 1.8411250213464316 7 0.5501345347917574 1.5605795821445807 8 0.39801393421292086 1.290349136407075 9 0.3177554090663994 1.1589226035499416 >10 2.0063978048273907 15.708788554798305 >50 0.23036152897315956 6.561814951189349 >100 0.18441924108243823 14.68238807678116 >500 0.012920636023483405 3.522333232988069 >1k 0.005229781238277098 3.191615038372972 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 4213 0.10532499999999999 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 1.5E-4 5.0E-5 0.0 0.0 0.0 2 2.5E-4 5.0E-5 0.0 0.0 0.0 3 4.75E-4 5.0E-5 0.0 0.0 0.0 4 0.00115 5.0E-5 0.0 0.0 0.0 5 0.001275 5.0E-5 0.0 0.0 0.0 6 0.001625 5.0E-5 0.0 0.0 0.0 7 0.0017 5.0E-5 0.0 0.0 0.0 8 0.001925 5.0E-5 0.0 0.0 0.0 9 0.0021 5.0E-5 0.0 0.0 0.0 10 0.002425 5.0E-5 0.0 0.0 0.0 11 0.002575 5.0E-5 0.0 0.0 0.0 12 0.002725 5.0E-5 0.0 0.0 0.0 13 0.002975 5.0E-5 0.0 0.0 0.0 14 0.0034 5.0E-5 0.0 0.0 0.0 15 0.003775 5.0E-5 0.0 0.0 0.0 16 0.004275 5.0E-5 0.0 0.0 0.0 17 0.004475 5.0E-5 0.0 0.0 0.0 18 0.004725 5.0E-5 0.0 0.0 0.0 19 0.00505 5.0E-5 0.0 0.0 0.0 20 0.0052 5.0E-5 0.0 0.0 0.0 21 0.005325 5.0E-5 0.0 0.0 0.0 22 0.005425 5.0E-5 0.0 0.0 0.0 23 0.00545 5.0E-5 0.0 0.0 0.0 24 0.005575 5.0E-5 0.0 0.0 0.0 25 0.00565 5.0E-5 0.0 0.0 0.0 26 0.005725 5.0E-5 0.0 0.0 0.0 27 0.00575 5.0E-5 0.0 0.0 0.0 28 0.0058 5.0E-5 0.0 0.0 0.0 29 0.005925 5.0E-5 0.0 0.0 0.0 30 0.006175 5.0E-5 0.0 0.0 0.0 31 0.006325 7.5E-5 0.0 0.0 0.0 32 0.006475 7.5E-5 0.0 0.0 0.0 33 0.006725 7.5E-5 0.0 0.0 0.0 34 0.007 7.5E-5 0.0 0.0 0.0 35 0.007225 7.5E-5 0.0 0.0 0.0 36 0.007575 1.0E-4 0.0 0.0 0.0 37 0.007925 1.0E-4 0.0 0.0 0.0 38 0.00825 1.25E-4 0.0 0.0 0.0 39 0.00835 1.25E-4 0.0 0.0 0.0 40 0.008775 1.25E-4 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGGATA 1525 0.0 18.096325 16 TCGCGTA 530 0.0 17.790451 2 GTCGCGT 560 0.0 17.285872 1 GATACGG 1365 0.0 16.679441 13 ATACGGA 1740 0.0 15.992454 14 GTCCGCT 220 1.5097612E-10 15.714429 1 CCTAGAT 640 0.0 15.485261 1 TGATACG 1470 0.0 15.331608 12 CGCGAGG 400 0.0 14.950934 40 CCGCGAG 400 0.0 14.948692 39 CGAACGT 465 0.0 14.839451 27 CGCGTAT 605 0.0 14.824779 3 GCGCACG 1055 0.0 14.604992 18 GTCGAAT 2185 0.0 14.451041 1 CGCACGC 1100 0.0 14.42565 19 AACGTAC 480 0.0 14.375718 29 GTCGCGA 180 8.572042E-7 14.084785 1 CACGCGT 1095 0.0 14.071475 21 ACGCGTC 1110 0.0 13.881321 22 GCGGAGT 450 0.0 13.798447 38 >>END_MODULE skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423532 SRR5423532_1.fastq Input file: SRR5423532_1.fastq trimmed: SRR5423532-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Tue Apr 15 04:20:37 2025 >> started Tue Apr 15 04:20:39 2025 >> done (1.943s) 4000000 reads processed; of these: 185 ( 0.00%) short reads filtered out after trimming by size control 132 ( 0.00%) empty reads filtered out after trimming by size control 3999683 (99.99%) reads available; of these: 24 ( 0.00%) trimmed reads available after processing 3999659 (100.00%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 6 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 0 0.00% 52 3999659 100.00% 3999683 reads passed initial QC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.31 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=18.07 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Apr 15 04:21:50 Started mapping on | Apr 15 04:21:50 Finished on | Apr 15 04:21:55 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999683 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3240072 Uniquely mapped reads % | 81.01% Average mapped length | 51.84 Number of splices: Total | 402561 Number of splices: Annotated (sjdb) | 397996 Number of splices: GT/AG | 395289 Number of splices: GC/AG | 6698 Number of splices: AT/AC | 176 Number of splices: Non-canonical | 398 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310806 % of reads mapped to multiple loci | 7.77% Number of reads mapped to too many loci | 429454 % of reads mapped to too many loci | 10.74% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448805 448805 448805 N_multimapping 310806 310806 310806 N_noFeature 284939 3186418 302152 N_ambiguous 52471 30 16010 UnstrandedReadsAssigned:2902662 PositiveStrandReadsAssigned:53624 NegativeStrandReadsAssigned:2921910 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423532 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423532-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,683 reads, 3,321,362 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR5423532.ke.tsv 34699 SRR5423532.se.tsv 87100 total ==> SRR5423532.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 56 8.80164 Potri.005G024800.1.v4.1 1035 936 4 1.28895 Potri.004G059700.1.v4.1 961 862 5.48827 1.92034 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30 3.18158 Potri.016G087400.1.v4.1 270 171 102 179.91 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 34 11.6798 ==> SRR5423532.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 76 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423532 completed mapping pipeline successfully