Starting /dee2/code/volunteer_pipeline.sh SRR5423533 current disk space = 3091445829632 free memory = 1500818348 SRR5423533 SRAfilesize 0d32f44f8be1d2ed896f07a769a49c1f SRR5423533.sra SRR5423533.sra file validated SRR5423533 is single end SRR5423533 is conventional basespace SRR5423533 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423533_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.20475 34.0 31.0 34.0 30.0 34.0 2 32.26025 34.0 31.0 34.0 30.0 34.0 3 32.40475 34.0 31.0 34.0 30.0 34.0 4 35.65575 37.0 35.0 37.0 33.0 37.0 5 35.8395 37.0 35.0 37.0 33.0 37.0 6 35.8925 37.0 35.0 37.0 35.0 37.0 7 35.8335 37.0 35.0 37.0 35.0 37.0 8 35.9005 37.0 35.0 37.0 35.0 37.0 9 37.56625 39.0 37.0 39.0 35.0 39.0 10 37.31925 39.0 37.0 39.0 33.0 39.0 11 37.49 39.0 37.0 39.0 35.0 39.0 12 37.422 39.0 37.0 39.0 34.0 39.0 13 37.4055 39.0 37.0 39.0 35.0 39.0 14 38.81025 40.0 38.0 41.0 34.0 41.0 15 38.56475 40.0 38.0 41.0 33.0 41.0 16 38.75175 40.0 38.0 41.0 34.0 41.0 17 38.755 40.0 38.0 41.0 35.0 41.0 18 38.723 40.0 38.0 41.0 35.0 41.0 19 38.51575 40.0 38.0 41.0 34.0 41.0 20 38.68325 40.0 38.0 41.0 34.0 41.0 21 38.5575 40.0 38.0 41.0 34.0 41.0 22 38.577 40.0 38.0 41.0 34.0 41.0 23 38.6255 40.0 38.0 41.0 34.0 41.0 24 38.638 40.0 38.0 41.0 34.0 41.0 25 38.7335 40.0 38.0 41.0 35.0 41.0 26 38.60675 40.0 38.0 41.0 34.0 41.0 27 38.3375 40.0 38.0 41.0 34.0 41.0 28 38.42325 40.0 38.0 41.0 34.0 41.0 29 38.41375 40.0 38.0 41.0 34.0 41.0 30 38.35875 40.0 38.0 41.0 34.0 41.0 31 38.33775 40.0 38.0 41.0 34.0 41.0 32 38.2825 40.0 38.0 41.0 34.0 41.0 33 38.23675 40.0 38.0 41.0 33.0 41.0 34 38.19075 40.0 38.0 41.0 33.0 41.0 35 38.2485 40.0 38.0 41.0 34.0 41.0 36 38.0955 40.0 38.0 41.0 33.0 41.0 37 38.1345 40.0 38.0 41.0 33.0 41.0 38 37.9755 40.0 38.0 41.0 33.0 41.0 39 37.95875 40.0 37.0 41.0 33.0 41.0 40 37.884 40.0 37.0 41.0 33.0 41.0 41 37.78075 40.0 37.0 41.0 32.0 41.0 42 37.2875 40.0 37.0 41.0 31.0 41.0 43 37.35975 40.0 37.0 41.0 31.0 41.0 44 37.10675 39.0 36.0 41.0 30.0 41.0 45 36.98225 39.0 36.0 41.0 30.0 41.0 46 37.254 40.0 36.0 41.0 31.0 41.0 47 37.26575 40.0 36.0 41.0 31.0 41.0 48 37.08675 39.0 36.0 41.0 31.0 41.0 49 36.99975 39.0 36.0 41.0 31.0 41.0 50 36.87525 39.0 35.0 41.0 30.0 41.0 51 36.93425 39.0 36.0 41.0 31.0 41.0 52 36.05125 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2210 1 0.0 2210 2 0.0 2210 3 0.0 2210 4 0.0 2210 5 0.0 2210 6 0.0 2210 7 0.0 2210 8 0.0 2210 9 0.0 2210 10 0.0 2210 11 0.0 2210 12 0.0 2210 13 0.0 2210 14 0.0 2210 15 0.0 2210 16 0.0 2210 17 0.0 2210 18 0.0 2210 19 0.0 2210 20 0.0 2210 21 0.0 2210 22 0.0 2210 23 0.0 2210 24 0.0 2210 25 0.0 2210 26 0.0 2210 27 0.0 2210 28 0.0 2210 29 0.0 2210 30 0.0 2210 31 0.0 2210 32 0.0 2210 33 0.0 2210 34 0.0 2210 35 0.0 2210 36 0.0 2210 37 0.0 2210 38 0.0 2210 39 0.0 2210 40 0.0 2210 41 0.0 2210 42 0.0 2210 43 0.0 2210 44 0.0 2210 45 0.0 2210 46 0.0 2210 47 0.0 2210 48 0.0 2210 49 0.0 2210 50 0.0 2210 51 0.0 2210 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 3.0 23 4.0 24 6.0 25 15.0 26 15.0 27 29.0 28 26.0 29 45.0 30 45.0 31 90.0 32 107.0 33 108.0 34 150.0 35 206.0 36 329.0 37 397.0 38 793.0 39 1628.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.02251125562781 13.031515757878939 5.977988994497249 35.967983991996 2 23.025000000000002 15.9 34.575 26.5 3 19.675 19.225 27.150000000000002 33.95 4 23.35 29.075 23.0 24.575 5 22.925 32.5 23.075000000000003 21.5 6 19.825 31.85 25.35 22.975 7 16.825000000000003 20.375 40.300000000000004 22.5 8 18.45 19.925 28.775000000000002 32.85 9 17.65 19.7 32.574999999999996 30.075000000000003 10 19.45 35.425000000000004 24.075 21.05 11 24.825 23.849999999999998 20.225 31.1 12 23.724999999999998 21.125 24.775 30.375000000000004 13 21.525 26.150000000000002 26.525 25.8 14 21.525 26.0 25.85 26.625 15 22.3 25.074999999999996 24.224999999999998 28.4 16 23.35 25.8 24.45 26.400000000000002 17 22.575 24.925 26.05 26.450000000000003 18 22.675 23.925 25.624999999999996 27.775 19 22.525000000000002 25.374999999999996 25.275 26.825 20 23.125 25.55 25.0 26.325 21 22.650000000000002 23.799999999999997 25.55 28.000000000000004 22 22.55 25.7 25.174999999999997 26.575 23 22.925 25.5 25.525 26.05 24 22.2 24.2 25.900000000000002 27.700000000000003 25 23.200000000000003 24.2 26.150000000000002 26.450000000000003 26 22.2 24.65 26.650000000000002 26.5 27 20.849999999999998 24.625 25.974999999999998 28.549999999999997 28 23.1 24.8 25.55 26.55 29 23.175 24.325 24.925 27.575 30 21.349999999999998 24.25 26.224999999999998 28.175 31 22.25 24.349999999999998 25.7 27.700000000000003 32 22.7 24.05 27.375 25.874999999999996 33 23.075000000000003 24.45 25.474999999999998 27.0 34 22.225 24.375 25.3 28.1 35 22.675 23.775 25.525 28.025 36 22.85 24.175 25.324999999999996 27.650000000000002 37 22.875 25.174999999999997 23.775 28.175 38 22.75 22.975 25.900000000000002 28.375 39 23.25 23.875 25.324999999999996 27.55 40 22.8 24.875 25.624999999999996 26.700000000000003 41 23.5 24.9 25.35 26.25 42 24.025 22.825 26.424999999999997 26.724999999999998 43 24.25 23.65 25.724999999999998 26.375 44 23.3 22.325 27.0 27.375 45 22.75 24.7 25.5 27.05 46 24.456114028507127 25.55638909727432 24.63115778944736 25.35633908477119 47 23.775 23.974999999999998 24.525 27.725 48 22.1055263815954 23.53088272068017 26.156539134783696 28.207051762940733 49 23.355838959739934 23.655913978494624 25.93148287071768 27.056764191047762 50 22.925 24.6 25.674999999999997 26.8 51 21.875 22.925 25.900000000000002 29.299999999999997 52 23.925 23.150000000000002 24.875 28.050000000000004 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 4.5 23 7.0 24 6.5 25 6.0 26 6.5 27 7.0 28 14.5 29 22.0 30 24.5 31 27.0 32 33.0 33 39.0 34 54.0 35 69.0 36 78.0 37 87.0 38 93.5 39 124.0 40 148.0 41 182.0 42 216.0 43 245.0 44 274.0 45 294.5 46 315.0 47 344.0 48 373.0 49 388.0 50 403.0 51 402.0 52 401.0 53 395.0 54 389.0 55 371.0 56 353.0 57 305.0 58 257.0 59 212.0 60 167.0 61 148.5 62 130.0 63 95.0 64 54.0 65 48.0 66 41.5 67 35.0 68 30.0 69 25.0 70 18.5 71 12.0 72 14.0 73 16.0 74 10.0 75 4.0 76 2.5 77 1.0 78 1.5 79 2.0 80 1.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.025 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 96.26806833114323 91.57499999999999 2 2.917214191852825 5.55 3 0.49934296977660975 1.425 4 0.15768725361366623 0.6 5 0.10512483574244415 0.5 6 0.0 0.0 7 0.052562417871222074 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 7 0.17500000000000002 No Hit GCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCA 7 0.17500000000000002 No Hit GTACAAGGCCCGGGAACGAATTCACCGCCGTATGGCTGACCGGCGATTACTA 5 0.125 No Hit GTTACGACTTCTCCTTCCTCTAAATGATAAGGTTCAGTGGACTTCTCGCGAC 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra Read 200000 spots for SRR5423533.sra Written 200000 spots for SRR5423533.sra SRR ids: ['SRR5423533.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qh0oo7bi SRR5423533.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423533 file size 703961 SRR5423533 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423533 SRR5423533_1.fastq Input file: SRR5423533_1.fastq trimmed: SRR5423533-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 12:56:23 2025 >> started Thu Feb 13 12:56:25 2025 >> done (1.935s) 4000000 reads processed; of these: 178 ( 0.00%) short reads filtered out after trimming by size control 141 ( 0.00%) empty reads filtered out after trimming by size control 3999681 (99.99%) reads available; of these: 78471 ( 1.96%) trimmed reads available after processing 3921210 (98.04%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 7 0.00% 25 7 0.00% 26 6 0.00% 27 22 0.00% 28 26 0.00% 29 34 0.00% 30 34 0.00% 31 42 0.00% 32 84 0.00% 33 58 0.00% 34 36 0.00% 35 70 0.00% 36 90 0.00% 37 126 0.00% 38 112 0.00% 39 99 0.00% 40 207 0.01% 41 261 0.01% 42 264 0.01% 43 355 0.01% 44 476 0.01% 45 796 0.02% 46 1157 0.03% 47 1477 0.04% 48 2085 0.05% 49 4124 0.10% 50 10044 0.25% 51 56351 1.41% 52 3921210 98.04% 3999681 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=36 prefix-density=0.36 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=17.92 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=CTTTGCTCCCAAATCAGTATCGGATGGCTGGACACTCTCAAACACTCCTATGACCTCTCCGGTCTCAGGCTT Started job on | Feb 13 12:56:40 Started mapping on | Feb 13 12:56:40 Finished on | Feb 13 12:56:45 Mapping speed, Million of reads per hour | 2879.77 Number of input reads | 3999681 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3240405 Uniquely mapped reads % | 81.02% Average mapped length | 51.83 Number of splices: Total | 401849 Number of splices: Annotated (sjdb) | 397450 Number of splices: GT/AG | 394476 Number of splices: GC/AG | 6815 Number of splices: AT/AC | 169 Number of splices: Non-canonical | 389 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 310684 % of reads mapped to multiple loci | 7.77% Number of reads mapped to too many loci | 432294 % of reads mapped to too many loci | 10.81% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.40% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 448592 448592 448592 N_multimapping 310684 310684 310684 N_noFeature 286575 3186915 303877 N_ambiguous 52235 27 16030 UnstrandedReadsAssigned:2901595 PositiveStrandReadsAssigned:53463 NegativeStrandReadsAssigned:2920498 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423533 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423533-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,681 reads, 3,314,486 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,104 rounds 52401 SRR5423533.ke.tsv 34699 SRR5423533.se.tsv 87100 total ==> SRR5423533.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 62 9.76969 Potri.005G024800.1.v4.1 1035 936 5.01274 1.61943 Potri.004G059700.1.v4.1 961 862 9 3.15718 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 37.4608 3.98301 Potri.016G087400.1.v4.1 270 171 85 150.31 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 32 11.021 ==> SRR5423533.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423533 completed mapping pipeline successfully