Starting /dee2/code/volunteer_pipeline.sh SRR5423534 current disk space = 3090997391360 free memory = 1459746820 SRR5423534 SRAfilesize 1a247d12ec5214cbbd349e00488042bc SRR5423534.sra SRR5423534.sra file validated SRR5423534 is single end SRR5423534 is conventional basespace SRR5423534 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423534_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.37425 34.0 31.0 34.0 30.0 34.0 2 32.40325 34.0 31.0 34.0 30.0 34.0 3 32.54 34.0 31.0 34.0 31.0 34.0 4 35.92275 37.0 35.0 37.0 35.0 37.0 5 35.93575 37.0 35.0 37.0 35.0 37.0 6 35.74475 37.0 35.0 37.0 35.0 37.0 7 35.9185 37.0 35.0 37.0 35.0 37.0 8 35.87025 37.0 35.0 37.0 35.0 37.0 9 37.648 39.0 37.0 39.0 35.0 39.0 10 37.57275 39.0 37.0 39.0 35.0 39.0 11 37.68825 39.0 37.0 39.0 35.0 39.0 12 37.67475 39.0 37.0 39.0 35.0 39.0 13 37.614 39.0 37.0 39.0 35.0 39.0 14 38.876 40.0 38.0 41.0 36.0 41.0 15 38.8565 40.0 38.0 41.0 35.0 41.0 16 38.74325 40.0 38.0 41.0 35.0 41.0 17 38.7575 40.0 38.0 41.0 35.0 41.0 18 38.67575 40.0 38.0 41.0 34.0 41.0 19 38.73825 40.0 38.0 41.0 34.0 41.0 20 38.82525 40.0 38.0 41.0 35.0 41.0 21 38.82925 40.0 38.0 41.0 35.0 41.0 22 38.7995 40.0 38.0 41.0 35.0 41.0 23 38.756 40.0 38.0 41.0 34.0 41.0 24 38.76825 40.0 38.0 41.0 35.0 41.0 25 38.679 40.0 38.0 41.0 34.0 41.0 26 38.639 40.0 38.0 41.0 35.0 41.0 27 38.62675 40.0 38.0 41.0 34.0 41.0 28 38.54225 40.0 38.0 41.0 34.0 41.0 29 38.57775 40.0 38.0 41.0 34.0 41.0 30 38.5755 40.0 38.0 41.0 35.0 41.0 31 38.4045 40.0 38.0 41.0 34.0 41.0 32 38.6015 40.0 38.0 41.0 35.0 41.0 33 38.41925 40.0 38.0 41.0 34.0 41.0 34 38.3025 40.0 38.0 41.0 34.0 41.0 35 38.27775 40.0 38.0 41.0 34.0 41.0 36 38.26325 40.0 38.0 41.0 34.0 41.0 37 38.2215 40.0 38.0 41.0 33.0 41.0 38 38.211 40.0 38.0 41.0 33.0 41.0 39 38.012 40.0 38.0 41.0 33.0 41.0 40 37.8085 40.0 37.0 41.0 33.0 41.0 41 37.896 40.0 37.0 41.0 33.0 41.0 42 37.628 40.0 37.0 41.0 32.0 41.0 43 37.703 40.0 37.0 41.0 32.0 41.0 44 37.536 40.0 37.0 41.0 32.0 41.0 45 37.4735 40.0 37.0 41.0 32.0 41.0 46 37.3055 40.0 37.0 41.0 31.0 41.0 47 37.15825 40.0 36.0 41.0 31.0 41.0 48 37.113 40.0 36.0 41.0 31.0 41.0 49 37.15325 40.0 36.0 41.0 31.0 41.0 50 37.02925 39.0 36.0 41.0 31.0 41.0 51 37.02825 39.0 36.0 41.0 31.0 41.0 52 35.8475 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2306 1 0.0 2306 2 0.0 2306 3 0.0 2306 4 0.0 2306 5 0.0 2306 6 0.0 2306 7 0.0 2306 8 0.0 2306 9 0.0 2306 10 0.0 2306 11 0.0 2306 12 0.0 2306 13 0.0 2306 14 0.0 2306 15 0.0 2306 16 0.0 2306 17 0.0 2306 18 0.0 2306 19 0.0 2306 20 0.0 2306 21 0.0 2306 22 0.0 2306 23 0.0 2306 24 0.0 2306 25 0.0 2306 26 0.0 2306 27 0.0 2306 28 0.0 2306 29 0.0 2306 30 0.0 2306 31 0.0 2306 32 0.0 2306 33 0.0 2306 34 0.0 2306 35 0.0 2306 36 0.0 2306 37 0.0 2306 38 0.0 2306 39 0.0 2306 40 0.0 2306 41 0.0 2306 42 0.0 2306 43 0.0 2306 44 0.0 2306 45 0.0 2306 46 0.0 2306 47 0.0 2306 48 0.0 2306 49 0.0 2306 50 0.0 2306 51 0.0 2306 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 2.0 21 1.0 22 3.0 23 6.0 24 1.0 25 8.0 26 14.0 27 24.0 28 33.0 29 41.0 30 41.0 31 68.0 32 90.0 33 106.0 34 161.0 35 191.0 36 277.0 37 440.0 38 747.0 39 1740.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 13.225000000000001 5.45 37.375 2 23.025000000000002 16.375 34.449999999999996 26.150000000000002 3 20.225 20.599999999999998 25.35 33.825 4 26.150000000000002 27.500000000000004 22.175 24.175 5 23.7 33.625 22.425 20.25 6 20.724999999999998 32.7 22.325 24.25 7 15.5 20.9 41.325 22.275 8 18.525 19.7 30.525000000000002 31.25 9 19.5 19.25 31.474999999999998 29.775000000000002 10 19.950000000000003 35.0 23.575 21.475 11 23.95 23.075000000000003 20.325 32.65 12 22.575 20.65 25.424999999999997 31.35 13 21.375 25.35 26.950000000000003 26.325 14 21.425 24.9 27.55 26.125 15 22.5 23.875 26.075 27.55 16 22.1 24.125 25.5 28.275 17 21.95 24.75 26.400000000000002 26.900000000000002 18 22.1 22.95 27.150000000000002 27.800000000000004 19 21.75 25.0 26.1 27.150000000000002 20 21.475 24.5 27.375 26.650000000000002 21 22.95573893473368 23.980995248812203 26.356589147286826 26.70667666916729 22 23.974999999999998 24.75 24.325 26.950000000000003 23 21.625 24.55 26.450000000000003 27.375 24 21.0 24.4 25.424999999999997 29.175 25 24.875 24.625 24.825 25.674999999999997 26 22.6 23.75 26.25 27.400000000000002 27 23.0 23.7 25.2 28.1 28 23.275000000000002 24.775 24.825 27.125 29 22.325 24.85 25.95 26.875 30 22.725 23.7 26.150000000000002 27.425 31 21.925 24.925 25.45 27.700000000000003 32 21.875 24.7 26.150000000000002 27.275 33 23.674999999999997 23.1 25.650000000000002 27.575 34 22.175 23.95 27.325 26.55 35 23.275000000000002 24.25 25.650000000000002 26.825 36 21.85 25.4 24.725 28.025 37 23.45 23.75 23.25 29.549999999999997 38 23.799999999999997 23.9 25.3 27.0 39 22.625 23.799999999999997 25.2 28.375 40 23.925 24.349999999999998 24.65 27.075 41 24.2 25.275 23.974999999999998 26.55 42 22.8 23.3 25.624999999999996 28.275 43 23.9 23.775 25.724999999999998 26.6 44 23.9 22.400000000000002 26.424999999999997 27.275 45 24.256064016004 22.73068267066767 25.831457864466117 27.181795448862218 46 23.93098274568642 24.781195298824706 23.95598899724931 27.33183295823956 47 23.005751437859466 23.755938984746187 25.03125781445361 28.207051762940733 48 22.455613903475868 22.95573893473368 25.35633908477119 29.232308077019255 49 23.95 23.200000000000003 25.124999999999996 27.725 50 22.705676419104776 23.93098274568642 26.231557889472366 27.131782945736433 51 22.625 23.75 24.725 28.9 52 24.325 24.725 23.799999999999997 27.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 2.0 23 1.0 24 3.0 25 5.0 26 9.0 27 13.0 28 14.5 29 16.0 30 20.5 31 25.0 32 32.5 33 40.0 34 51.5 35 63.0 36 69.0 37 75.0 38 85.0 39 129.5 40 164.0 41 192.5 42 221.0 43 236.5 44 252.0 45 286.5 46 321.0 47 358.5 48 396.0 49 391.5 50 387.0 51 396.5 52 406.0 53 387.0 54 368.0 55 357.0 56 346.0 57 293.5 58 241.0 59 216.0 60 191.0 61 167.5 62 144.0 63 99.0 64 50.0 65 46.0 66 39.0 67 32.0 68 29.0 69 26.0 70 23.5 71 21.0 72 20.5 73 20.0 74 16.0 75 12.0 76 9.0 77 6.0 78 5.5 79 5.0 80 3.5 81 2.0 82 1.0 83 0.0 84 1.0 85 2.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 95.86188719030048 90.925 2 3.215603584607275 6.1 3 0.7116499736425936 2.025 4 0.10542962572482868 0.4 5 0.05271481286241434 0.25 6 0.05271481286241434 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit CCAGAACCCAAAAACTTTGATTTCTCATAAGGTGCTGGCGGAGTCCTAAAAG 6 0.15 No Hit GTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGCTAGCTCT 5 0.125 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182052 spots for SRR5423534.sra Written 182052 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra Read 182040 spots for SRR5423534.sra Written 182040 spots for SRR5423534.sra SRR ids: ['SRR5423534.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gtrrzh0g SRR5423534.sra spots: 3640812 blocks: [[1, 182040], [182041, 364080], [364081, 546120], [546121, 728160], [728161, 910200], [910201, 1092240], [1092241, 1274280], [1274281, 1456320], [1456321, 1638360], [1638361, 1820400], [1820401, 2002440], [2002441, 2184480], [2184481, 2366520], [2366521, 2548560], [2548561, 2730600], [2730601, 2912640], [2912641, 3094680], [3094681, 3276720], [3276721, 3458760], [3458761, 3640812]] SRR5423534 file size 640650 SRR5423534 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423534 SRR5423534_1.fastq Input file: SRR5423534_1.fastq trimmed: SRR5423534-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:21:58 2025 >> started Thu Feb 13 13:22:00 2025 >> done (1.917s) 3640812 reads processed; of these: 136 ( 0.00%) short reads filtered out after trimming by size control 120 ( 0.00%) empty reads filtered out after trimming by size control 3640556 (99.99%) reads available; of these: 61171 ( 1.68%) trimmed reads available after processing 3579385 (98.32%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 3 0.00% 25 7 0.00% 26 5 0.00% 27 4 0.00% 28 5 0.00% 29 7 0.00% 30 4 0.00% 31 13 0.00% 32 18 0.00% 33 27 0.00% 34 24 0.00% 35 39 0.00% 36 41 0.00% 37 45 0.00% 38 36 0.00% 39 66 0.00% 40 74 0.00% 41 95 0.00% 42 129 0.00% 43 131 0.00% 44 215 0.01% 45 403 0.01% 46 625 0.02% 47 718 0.02% 48 1147 0.03% 49 2527 0.07% 50 7005 0.19% 51 47739 1.31% 52 3579385 98.32% 3640556 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=36 prefix-density=0.35 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=16.51 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.4 sequence=CTTTGCTCCCAAATCAGTATCGGATGGCTGGACACTCTCAAACACTCCTATGACCTCTCCGGTCTCAGGCTT Started job on | Feb 13 13:22:13 Started mapping on | Feb 13 13:22:14 Finished on | Feb 13 13:22:19 Mapping speed, Million of reads per hour | 2621.20 Number of input reads | 3640556 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2948335 Uniquely mapped reads % | 80.99% Average mapped length | 51.84 Number of splices: Total | 363888 Number of splices: Annotated (sjdb) | 359806 Number of splices: GT/AG | 357383 Number of splices: GC/AG | 5938 Number of splices: AT/AC | 174 Number of splices: Non-canonical | 393 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280944 % of reads mapped to multiple loci | 7.72% Number of reads mapped to too many loci | 398358 % of reads mapped to too many loci | 10.94% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411277 411277 411277 N_multimapping 280944 280944 280944 N_noFeature 261986 2899793 277535 N_ambiguous 47633 35 14621 UnstrandedReadsAssigned:2638716 PositiveStrandReadsAssigned:48507 NegativeStrandReadsAssigned:2656179 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423534 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423534-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,640,556 reads, 3,021,479 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,070 rounds 52401 SRR5423534.ke.tsv 34699 SRR5423534.se.tsv 87100 total ==> SRR5423534.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 59 10.2041 Potri.005G024800.1.v4.1 1035 936 5 1.77293 Potri.004G059700.1.v4.1 961 862 3 1.15508 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 34 3.96777 Potri.016G087400.1.v4.1 270 171 85 164.976 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 19 7.18218 ==> SRR5423534.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 75 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423534 completed mapping pipeline successfully