Starting /dee2/code/volunteer_pipeline.sh SRR5423535 current disk space = 3051921408000 free memory = 1579671104 SRR5423535 SRAfilesize 9fc05f7f16562f738fbe415867b60ea6 SRR5423535.sra SRR5423535.sra file validated SRR5423535 is single end SRR5423535 is conventional basespace SRR5423535 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423535_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.23 34.0 31.0 34.0 26.0 34.0 2 31.53275 34.0 31.0 34.0 26.0 34.0 3 32.514 34.0 31.0 34.0 28.0 34.0 4 36.164 37.0 35.0 37.0 35.0 37.0 5 36.20825 37.0 37.0 37.0 35.0 37.0 6 36.21975 37.0 37.0 37.0 35.0 37.0 7 36.27125 37.0 37.0 37.0 35.0 37.0 8 36.29625 37.0 37.0 37.0 35.0 37.0 9 38.13825 39.0 39.0 39.0 37.0 39.0 10 37.9725 39.0 38.0 39.0 35.0 39.0 11 37.8885 39.0 38.0 39.0 35.0 39.0 12 38.03425 39.0 38.0 39.0 35.0 39.0 13 37.92475 39.0 38.0 39.0 35.0 39.0 14 39.4555 41.0 39.0 41.0 36.0 41.0 15 39.403 41.0 39.0 41.0 36.0 41.0 16 39.34725 41.0 39.0 41.0 36.0 41.0 17 39.377 41.0 39.0 41.0 36.0 41.0 18 39.39675 41.0 39.0 41.0 36.0 41.0 19 39.388 41.0 39.0 41.0 36.0 41.0 20 39.30425 41.0 39.0 41.0 36.0 41.0 21 39.108 41.0 39.0 41.0 36.0 41.0 22 39.09325 41.0 39.0 41.0 36.0 41.0 23 39.0465 40.0 39.0 41.0 36.0 41.0 24 39.05675 40.0 39.0 41.0 36.0 41.0 25 39.043 40.0 39.0 41.0 36.0 41.0 26 38.8995 40.0 39.0 41.0 35.0 41.0 27 38.769 40.0 39.0 41.0 35.0 41.0 28 38.835 40.0 39.0 41.0 35.0 41.0 29 38.74775 40.0 39.0 41.0 35.0 41.0 30 38.65025 40.0 39.0 41.0 35.0 41.0 31 38.61075 40.0 38.0 41.0 35.0 41.0 32 38.4855 40.0 38.0 41.0 34.0 41.0 33 38.3 40.0 38.0 41.0 34.0 41.0 34 38.39275 40.0 38.0 41.0 34.0 41.0 35 38.28825 40.0 38.0 41.0 34.0 41.0 36 38.24475 40.0 38.0 41.0 34.0 41.0 37 38.03425 40.0 38.0 41.0 33.0 41.0 38 37.90825 40.0 38.0 41.0 33.0 41.0 39 37.74275 40.0 38.0 41.0 33.0 41.0 40 37.6545 40.0 38.0 41.0 32.0 41.0 41 37.6345 40.0 38.0 41.0 32.0 41.0 42 37.4005 40.0 37.0 41.0 31.0 41.0 43 37.31075 40.0 37.0 41.0 31.0 41.0 44 37.1025 40.0 37.0 41.0 31.0 41.0 45 37.084 40.0 37.0 41.0 31.0 41.0 46 37.0945 40.0 37.0 41.0 30.0 41.0 47 37.062 40.0 36.0 41.0 31.0 41.0 48 36.84 40.0 36.0 41.0 30.0 41.0 49 36.6075 39.0 36.0 41.0 30.0 41.0 50 36.48725 39.0 36.0 41.0 29.0 41.0 51 36.38225 39.0 35.0 41.0 29.0 41.0 52 34.482 38.0 33.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 2.0 19 4.0 20 7.0 21 2.0 22 6.0 23 9.0 24 12.0 25 10.0 26 19.0 27 24.0 28 26.0 29 29.0 30 58.0 31 68.0 32 74.0 33 95.0 34 117.0 35 188.0 36 219.0 37 385.0 38 838.0 39 1793.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.2530779753762 11.573187414500683 5.5266757865937075 37.64705882352941 2 22.2 14.374999999999998 36.4 27.025 3 19.55 20.875 25.374999999999996 34.2 4 27.35 26.900000000000002 21.5 24.25 5 23.225 32.025 23.125 21.625 6 20.9 30.8 23.525 24.775 7 16.875 19.875 39.525 23.724999999999998 8 18.75 20.325 30.65 30.275000000000002 9 20.349999999999998 18.35 30.7 30.599999999999998 10 21.5 33.550000000000004 22.725 22.225 11 25.324999999999996 23.0 19.900000000000002 31.775 12 23.400000000000002 20.1 25.25 31.25 13 21.575 23.599999999999998 27.025 27.800000000000004 14 22.525000000000002 23.599999999999998 26.200000000000003 27.675 15 21.775 24.45 25.1 28.675 16 22.8 23.3 24.925 28.975 17 24.15 22.6 25.874999999999996 27.375 18 23.25 23.474999999999998 24.75 28.525 19 23.674999999999997 22.525000000000002 25.374999999999996 28.425 20 22.975 23.825 26.6 26.6 21 23.825 23.575 25.124999999999996 27.474999999999998 22 23.825 23.375 26.200000000000003 26.6 23 22.225 23.45 25.650000000000002 28.675 24 23.825 23.75 24.05 28.375 25 22.95 22.775000000000002 26.450000000000003 27.825 26 23.3 21.925 26.900000000000002 27.875 27 22.725 22.975 26.55 27.750000000000004 28 24.224999999999998 22.025 26.05 27.700000000000003 29 23.95 23.775 24.9 27.375 30 22.3 24.175 24.875 28.65 31 23.075000000000003 22.725 25.6 28.599999999999998 32 23.5 22.225 26.55 27.725 33 22.900000000000002 23.1 26.724999999999998 27.275 34 22.8 23.775 25.275 28.15 35 23.075000000000003 23.05 26.125 27.750000000000004 36 22.650000000000002 22.775000000000002 25.674999999999997 28.9 37 22.775000000000002 23.625 25.825 27.775 38 23.0 23.325000000000003 24.025 29.65 39 22.425 23.25 24.675 29.65 40 23.974999999999998 23.3 25.25 27.474999999999998 41 24.425 23.0 24.625 27.950000000000003 42 23.75 22.475 26.950000000000003 26.825 43 24.9 22.025 26.05 27.025 44 24.224999999999998 24.0 25.025 26.75 45 23.65 21.85 26.200000000000003 28.299999999999997 46 24.0 24.349999999999998 25.575 26.075 47 25.174999999999997 21.925 24.349999999999998 28.549999999999997 48 23.375 23.0 23.599999999999998 30.025000000000002 49 24.05 22.975 24.7 28.275 50 23.674999999999997 22.95 25.3 28.075 51 24.099999999999998 23.375 23.65 28.875 52 24.325 22.650000000000002 24.925 28.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 2.0 21 4.0 22 3.0 23 2.0 24 6.0 25 10.0 26 9.5 27 9.0 28 12.5 29 16.0 30 19.5 31 23.0 32 25.0 33 27.0 34 40.0 35 53.0 36 61.5 37 70.0 38 85.5 39 121.0 40 141.0 41 166.0 42 191.0 43 213.5 44 236.0 45 269.5 46 303.0 47 322.0 48 341.0 49 341.0 50 341.0 51 382.0 52 423.0 53 410.0 54 397.0 55 363.5 56 330.0 57 301.5 58 273.0 59 240.5 60 208.0 61 186.5 62 165.0 63 117.5 64 68.0 65 66.0 66 57.5 67 49.0 68 46.0 69 43.0 70 40.0 71 37.0 72 31.5 73 26.0 74 20.0 75 14.0 76 12.5 77 11.0 78 8.5 79 6.0 80 6.0 81 6.0 82 5.0 83 4.0 84 2.0 85 0.0 86 1.0 87 2.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.725 #Duplication Level Percentage of deduplicated Percentage of total 1 93.38660788095893 84.725 2 4.546707081840728 8.25 3 1.2400110223201983 3.375 4 0.468448608432075 1.7000000000000002 5 0.19289060347203085 0.8750000000000001 6 0.08266740148801323 0.44999999999999996 7 0.055111600992008826 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.027555800496004413 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 11 0.27499999999999997 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 7 0.17500000000000002 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCC 7 0.17500000000000002 No Hit CTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCC 6 0.15 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 6 0.15 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCA 6 0.15 No Hit GTACAAGGCCCGGGAACGAATTCACCGCCGTATGGCTGACCGGCGATTACTA 5 0.125 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGT 5 0.125 No Hit GCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGG 5 0.125 No Hit GTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit GCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGAC 5 0.125 No Hit GCCGACTTTCGTCCCTGCTCGACGGGTGGGTCTTGCAGTCAAGCTCCCTTCT 5 0.125 No Hit GTCGGATTCCCCTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.025 0.0 33 0.0 0.0 0.0 0.025 0.0 34 0.0 0.0 0.0 0.025 0.0 35 0.0 0.0 0.0 0.025 0.0 36 0.0 0.0 0.0 0.025 0.0 37 0.0 0.0 0.0 0.025 0.0 38 0.0 0.0 0.0 0.025 0.0 39 0.0 0.0 0.0 0.025 0.0 40 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra Read 200000 spots for SRR5423535.sra Written 200000 spots for SRR5423535.sra SRR ids: ['SRR5423535.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_36ec40zv SRR5423535.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423535 file size 704005 SRR5423535 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423535 SRR5423535_1.fastq Input file: SRR5423535_1.fastq trimmed: SRR5423535-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:08:55 2025 >> started Wed Feb 12 17:08:57 2025 >> done (1.928s) 4000000 reads processed; of these: 293 ( 0.01%) short reads filtered out after trimming by size control 144 ( 0.00%) empty reads filtered out after trimming by size control 3999563 (99.99%) reads available; of these: 100538 ( 2.51%) trimmed reads available after processing 3899025 (97.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 13 0.00% 21 0 0.00% 22 5 0.00% 23 9 0.00% 24 12 0.00% 25 28 0.00% 26 43 0.00% 27 45 0.00% 28 69 0.00% 29 61 0.00% 30 78 0.00% 31 138 0.00% 32 235 0.01% 33 182 0.00% 34 184 0.00% 35 191 0.00% 36 224 0.01% 37 289 0.01% 38 297 0.01% 39 304 0.01% 40 483 0.01% 41 582 0.01% 42 559 0.01% 43 716 0.02% 44 909 0.02% 45 2002 0.05% 46 2732 0.07% 47 2698 0.07% 48 3440 0.09% 49 6417 0.16% 50 12842 0.32% 51 64732 1.62% 52 3899025 97.49% 3999563 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=33 prefix-density=0.57 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=21.89 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 12 17:09:13 Started mapping on | Feb 12 17:09:13 Finished on | Feb 12 17:09:21 Mapping speed, Million of reads per hour | 1799.80 Number of input reads | 3999563 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2711716 Uniquely mapped reads % | 67.80% Average mapped length | 51.82 Number of splices: Total | 318250 Number of splices: Annotated (sjdb) | 314148 Number of splices: GT/AG | 311605 Number of splices: GC/AG | 6120 Number of splices: AT/AC | 189 Number of splices: Non-canonical | 336 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276223 % of reads mapped to multiple loci | 6.91% Number of reads mapped to too many loci | 991611 % of reads mapped to too many loci | 24.79% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1011624 1011624 1011624 N_multimapping 276223 276223 276223 N_noFeature 406459 2646592 421580 N_ambiguous 60738 40 10710 UnstrandedReadsAssigned:2244519 PositiveStrandReadsAssigned:65084 NegativeStrandReadsAssigned:2279426 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423535 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423535-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,563 reads, 2,971,541 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 983 rounds 52401 SRR5423535.ke.tsv 34699 SRR5423535.se.tsv 87100 total ==> SRR5423535.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 58 10.0908 Potri.005G024800.1.v4.1 1035 936 13 4.63702 Potri.004G059700.1.v4.1 961 862 9 3.48584 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30 3.52179 Potri.016G087400.1.v4.1 270 171 88 171.814 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 31 11.788 ==> SRR5423535.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 40 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423535 completed mapping pipeline successfully