Starting /dee2/code/volunteer_pipeline.sh SRR5423536 current disk space = 3051799138304 free memory = 1581972764 SRR5423536 SRAfilesize 8f6fd1f44e3bf56d848ea55db0407e66 SRR5423536.sra SRR5423536.sra file validated SRR5423536 is single end SRR5423536 is conventional basespace SRR5423536 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423536_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.82125 33.0 31.0 34.0 30.0 34.0 2 32.13775 34.0 31.0 34.0 30.0 34.0 3 32.282 34.0 31.0 34.0 30.0 34.0 4 35.59925 37.0 35.0 37.0 33.0 37.0 5 35.68875 37.0 35.0 37.0 33.0 37.0 6 35.80775 37.0 35.0 37.0 33.0 37.0 7 35.84 37.0 35.0 37.0 35.0 37.0 8 35.8815 37.0 35.0 37.0 35.0 37.0 9 37.421 39.0 37.0 39.0 35.0 39.0 10 37.4565 39.0 37.0 39.0 35.0 39.0 11 37.38875 39.0 37.0 39.0 34.0 39.0 12 37.40825 39.0 37.0 39.0 34.0 39.0 13 37.29475 39.0 37.0 39.0 34.0 39.0 14 38.5475 40.0 38.0 41.0 34.0 41.0 15 38.6685 40.0 38.0 41.0 34.0 41.0 16 38.609 40.0 38.0 41.0 34.0 41.0 17 38.619 40.0 38.0 41.0 34.0 41.0 18 38.5275 40.0 38.0 41.0 34.0 41.0 19 38.5555 40.0 38.0 41.0 34.0 41.0 20 38.54675 40.0 38.0 41.0 34.0 41.0 21 38.58875 40.0 38.0 41.0 34.0 41.0 22 38.624 40.0 38.0 41.0 34.0 41.0 23 38.5495 40.0 38.0 41.0 34.0 41.0 24 38.4875 40.0 38.0 41.0 34.0 41.0 25 38.313 40.0 38.0 41.0 34.0 41.0 26 38.45625 40.0 38.0 41.0 34.0 41.0 27 38.46725 40.0 38.0 41.0 34.0 41.0 28 38.35225 40.0 38.0 41.0 34.0 41.0 29 38.103 40.0 38.0 41.0 33.0 41.0 30 38.018 40.0 38.0 41.0 33.0 41.0 31 38.266 40.0 38.0 41.0 34.0 41.0 32 38.0825 40.0 37.0 41.0 33.0 41.0 33 38.00525 40.0 38.0 41.0 33.0 41.0 34 38.1265 40.0 38.0 41.0 33.0 41.0 35 38.1355 40.0 38.0 41.0 33.0 41.0 36 37.98175 40.0 38.0 41.0 33.0 41.0 37 37.98225 40.0 38.0 41.0 33.0 41.0 38 37.93675 40.0 37.0 41.0 33.0 41.0 39 37.92775 40.0 37.0 41.0 33.0 41.0 40 37.81625 40.0 37.0 41.0 33.0 41.0 41 37.7815 40.0 37.0 41.0 33.0 41.0 42 37.63325 40.0 37.0 41.0 32.0 41.0 43 37.40825 40.0 36.0 41.0 31.0 41.0 44 37.316 40.0 36.0 41.0 31.0 41.0 45 37.37725 40.0 36.0 41.0 31.0 41.0 46 37.09 40.0 36.0 41.0 31.0 41.0 47 37.0195 39.0 35.0 41.0 31.0 41.0 48 37.01875 39.0 35.0 41.0 31.0 41.0 49 37.0145 39.0 35.0 41.0 31.0 41.0 50 36.83175 39.0 35.0 41.0 31.0 41.0 51 36.79725 39.0 35.0 41.0 30.0 41.0 52 35.71775 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 1.0 21 2.0 22 2.0 23 4.0 24 7.0 25 10.0 26 20.0 27 23.0 28 33.0 29 46.0 30 63.0 31 81.0 32 99.0 33 139.0 34 147.0 35 219.0 36 325.0 37 444.0 38 741.0 39 1585.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.57472417251755 13.11434302908726 5.717151454363089 39.593781344032095 2 21.5 15.925 35.675000000000004 26.900000000000002 3 20.349999999999998 18.925 24.95 35.775 4 25.0 27.075 22.075 25.85 5 23.674999999999997 31.8 22.400000000000002 22.125 6 20.375 31.775 23.7 24.15 7 16.825000000000003 19.175 41.199999999999996 22.8 8 18.875 18.725 28.849999999999998 33.550000000000004 9 19.1 18.9 31.974999999999998 30.025000000000002 10 21.675 33.15 22.475 22.7 11 24.95 23.9 19.45 31.7 12 23.724999999999998 18.925 25.674999999999997 31.674999999999997 13 21.05 23.974999999999998 27.950000000000003 27.025 14 22.45 23.200000000000003 26.3 28.050000000000004 15 23.9 22.675 26.3 27.125 16 23.925 23.75 25.074999999999996 27.250000000000004 17 23.674999999999997 23.200000000000003 25.775 27.35 18 22.375 22.45 26.075 29.099999999999998 19 23.1 24.349999999999998 24.425 28.125 20 23.0 24.224999999999998 24.45 28.325 21 22.95 22.95 25.85 28.249999999999996 22 22.5 24.325 25.074999999999996 28.1 23 22.975 23.625 24.925 28.475 24 23.325000000000003 23.724999999999998 25.6 27.35 25 23.25 23.400000000000002 25.924999999999997 27.425 26 22.5 22.375 26.025 29.099999999999998 27 21.349999999999998 23.35 26.8 28.499999999999996 28 23.65 22.75 26.35 27.250000000000004 29 21.625 22.2 26.174999999999997 30.0 30 21.675 23.549999999999997 26.525 28.249999999999996 31 23.425 22.625 25.05 28.9 32 24.775 20.65 26.0 28.575 33 22.5 22.975 25.874999999999996 28.65 34 22.975 23.325000000000003 25.650000000000002 28.050000000000004 35 23.625 23.799999999999997 24.325 28.249999999999996 36 21.975 24.175 25.224999999999998 28.625 37 22.15 23.525 25.124999999999996 29.2 38 21.525 23.3 25.275 29.9 39 22.775000000000002 23.25 23.974999999999998 30.0 40 23.724999999999998 23.125 24.525 28.625 41 23.75 23.5 24.95 27.800000000000004 42 24.2 22.35 24.975 28.475 43 23.7 23.425 25.124999999999996 27.750000000000004 44 25.124999999999996 22.875 26.25 25.75 45 23.125 23.799999999999997 24.125 28.95 46 24.625 23.200000000000003 24.7 27.474999999999998 47 23.974999999999998 23.1 24.925 28.000000000000004 48 23.375 23.375 25.0 28.249999999999996 49 23.775 22.2 25.85 28.175 50 23.05 23.7 25.124999999999996 28.125 51 23.425 23.625 25.2 27.750000000000004 52 24.275 22.6 24.275 28.849999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.0 21 2.0 22 2.5 23 3.0 24 3.5 25 4.0 26 5.5 27 7.0 28 10.5 29 14.0 30 18.5 31 23.0 32 34.5 33 46.0 34 44.0 35 42.0 36 51.0 37 60.0 38 90.0 39 128.5 40 137.0 41 161.0 42 185.0 43 218.5 44 252.0 45 250.5 46 249.0 47 277.0 48 305.0 49 331.0 50 357.0 51 379.0 52 401.0 53 402.5 54 404.0 55 395.5 56 387.0 57 350.0 58 313.0 59 258.0 60 203.0 61 168.5 62 134.0 63 109.5 64 79.0 65 73.0 66 60.5 67 48.0 68 48.5 69 49.0 70 45.0 71 41.0 72 37.0 73 33.0 74 23.5 75 14.0 76 8.0 77 2.0 78 2.0 79 2.0 80 1.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.825 #Duplication Level Percentage of deduplicated Percentage of total 1 92.26006191950464 81.95 2 5.037996059667886 8.95 3 1.4354066985645932 3.8249999999999997 4 0.7880664227413453 2.8000000000000003 5 0.28145229383619474 1.25 6 0.11258091753447791 0.6 7 0.056290458767238954 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.028145229383619477 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCAAACTTCCTTGGCCTGGAAGGCCATAGTCCCTCTAAGAAGCTGGCCGCG 11 0.27499999999999997 No Hit CATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCACAGACCTG 7 0.17500000000000002 No Hit GTTCGATTAGTCTTTCGCCCCTATACCCAAGTCAGACGAACGATTTGCACGT 7 0.17500000000000002 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGAC 6 0.15 No Hit CTCTAAGAAGCTGGCCGCGGAGGGTCACCTCCGCATAGCTAGTTAGCAGGCT 6 0.15 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 6 0.15 No Hit GCCGACGTCTCCGGACTCCCTAACGTTGCCGTCAGCCGCCACGTCCCGGTTC 5 0.125 No Hit GTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGGAATCTC 5 0.125 No Hit AGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAG 5 0.125 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 5 0.125 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCG 5 0.125 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCT 5 0.125 No Hit ATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAACC 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit GTCGGATTCCCCTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGG 5 0.125 No Hit CTTGTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra Read 200000 spots for SRR5423536.sra Written 200000 spots for SRR5423536.sra SRR ids: ['SRR5423536.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t8xq7a2w SRR5423536.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423536 file size 704005 SRR5423536 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423536 SRR5423536_1.fastq Input file: SRR5423536_1.fastq trimmed: SRR5423536-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:14:08 2025 >> started Wed Feb 12 17:14:11 2025 >> done (2.619s) 4000000 reads processed; of these: 333 ( 0.01%) short reads filtered out after trimming by size control 167 ( 0.00%) empty reads filtered out after trimming by size control 3999500 (99.99%) reads available; of these: 113661 ( 2.84%) trimmed reads available after processing 3885839 (97.16%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 9 0.00% 20 15 0.00% 21 3 0.00% 22 5 0.00% 23 11 0.00% 24 15 0.00% 25 46 0.00% 26 57 0.00% 27 83 0.00% 28 119 0.00% 29 134 0.00% 30 134 0.00% 31 202 0.01% 32 268 0.01% 33 254 0.01% 34 192 0.00% 35 196 0.00% 36 215 0.01% 37 358 0.01% 38 390 0.01% 39 375 0.01% 40 577 0.01% 41 763 0.02% 42 820 0.02% 43 1045 0.03% 44 1270 0.03% 45 1893 0.05% 46 2549 0.06% 47 2903 0.07% 48 3750 0.09% 49 6649 0.17% 50 14543 0.36% 51 73801 1.85% 52 3885839 97.16% 3999500 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.57 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=19.93 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 12 17:14:24 Started mapping on | Feb 12 17:14:24 Finished on | Feb 12 17:14:30 Mapping speed, Million of reads per hour | 2399.70 Number of input reads | 3999500 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2713360 Uniquely mapped reads % | 67.84% Average mapped length | 51.81 Number of splices: Total | 318306 Number of splices: Annotated (sjdb) | 314231 Number of splices: GT/AG | 311661 Number of splices: GC/AG | 6100 Number of splices: AT/AC | 202 Number of splices: Non-canonical | 343 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.54 Insertion rate per base | 0.00% Insertion average length | 1.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276711 % of reads mapped to multiple loci | 6.92% Number of reads mapped to too many loci | 987441 % of reads mapped to too many loci | 24.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.55% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1009429 1009429 1009429 N_multimapping 276711 276711 276711 N_noFeature 406076 2648017 421118 N_ambiguous 61010 33 10691 UnstrandedReadsAssigned:2246274 PositiveStrandReadsAssigned:65310 NegativeStrandReadsAssigned:2281551 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423536 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423536-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,500 reads, 2,969,362 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 994 rounds 52401 SRR5423536.ke.tsv 34699 SRR5423536.se.tsv 87100 total ==> SRR5423536.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 55 9.58474 Potri.005G024800.1.v4.1 1035 936 11 3.93015 Potri.004G059700.1.v4.1 961 862 4 1.55183 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 24.5084 2.88189 Potri.016G087400.1.v4.1 270 171 58 113.429 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199773 Potri.012G127500.1.v4.1 977 878 30 11.4267 ==> SRR5423536.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 44 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423536 completed mapping pipeline successfully