Starting /dee2/code/volunteer_pipeline.sh SRR5423538 current disk space = 3051737903104 free memory = 1580754864 SRR5423538 SRAfilesize 71fce82c2a1b4d07e489f17e1cd4157f SRR5423538.sra SRR5423538.sra file validated SRR5423538 is single end SRR5423538 is conventional basespace SRR5423538 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423538_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57975 34.0 31.0 34.0 31.0 34.0 2 32.70975 34.0 31.0 34.0 31.0 34.0 3 32.812 34.0 31.0 34.0 31.0 34.0 4 36.10075 37.0 37.0 37.0 35.0 37.0 5 36.166 37.0 37.0 37.0 35.0 37.0 6 36.1335 37.0 36.0 37.0 35.0 37.0 7 36.1335 37.0 36.0 37.0 35.0 37.0 8 36.128 37.0 36.0 37.0 35.0 37.0 9 37.85 39.0 38.0 39.0 35.0 39.0 10 37.81725 39.0 38.0 39.0 35.0 39.0 11 37.80825 39.0 38.0 39.0 35.0 39.0 12 37.65725 39.0 38.0 39.0 35.0 39.0 13 37.78875 39.0 38.0 39.0 35.0 39.0 14 39.3015 41.0 39.0 41.0 36.0 41.0 15 39.198 41.0 39.0 41.0 36.0 41.0 16 39.1695 40.0 39.0 41.0 36.0 41.0 17 39.14225 40.0 39.0 41.0 36.0 41.0 18 39.0605 40.0 39.0 41.0 36.0 41.0 19 39.08125 40.0 39.0 41.0 36.0 41.0 20 38.96 40.0 39.0 41.0 35.0 41.0 21 38.95225 40.0 39.0 41.0 35.0 41.0 22 38.95575 40.0 39.0 41.0 35.0 41.0 23 38.877 40.0 39.0 41.0 35.0 41.0 24 38.84725 40.0 38.0 41.0 35.0 41.0 25 38.953 40.0 39.0 41.0 35.0 41.0 26 38.8115 40.0 39.0 41.0 35.0 41.0 27 38.691 40.0 39.0 41.0 34.0 41.0 28 38.712 40.0 38.0 41.0 35.0 41.0 29 38.55325 40.0 38.0 41.0 34.0 41.0 30 38.52075 40.0 38.0 41.0 34.0 41.0 31 38.34175 40.0 38.0 41.0 34.0 41.0 32 38.30575 40.0 38.0 41.0 34.0 41.0 33 38.27825 40.0 38.0 41.0 34.0 41.0 34 38.1375 40.0 38.0 41.0 33.0 41.0 35 38.16675 40.0 38.0 41.0 33.0 41.0 36 37.87325 40.0 38.0 41.0 33.0 41.0 37 37.842 40.0 38.0 41.0 33.0 41.0 38 37.92175 40.0 38.0 41.0 33.0 41.0 39 37.69575 40.0 38.0 41.0 32.0 41.0 40 37.618 40.0 37.0 41.0 32.0 41.0 41 37.4975 40.0 37.0 41.0 32.0 41.0 42 37.354 40.0 37.0 41.0 31.0 41.0 43 37.178 40.0 37.0 41.0 31.0 41.0 44 37.2135 40.0 37.0 41.0 31.0 41.0 45 36.92775 40.0 36.0 41.0 31.0 41.0 46 36.89475 40.0 36.0 41.0 30.0 41.0 47 36.95075 40.0 36.0 41.0 31.0 41.0 48 36.51075 39.0 35.0 41.0 29.0 41.0 49 36.41275 39.0 35.0 41.0 29.0 41.0 50 36.314 39.0 35.0 41.0 29.0 41.0 51 36.20725 39.0 35.0 41.0 28.0 41.0 52 34.56975 38.0 33.0 40.0 23.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1302 1 0.0 1302 2 0.0 1302 3 0.0 1302 4 0.0 1302 5 0.0 1302 6 0.0 1302 7 0.0 1302 8 0.0 1302 9 0.0 1302 10 0.0 1302 11 0.0 1302 12 0.0 1302 13 0.0 1302 14 0.0 1302 15 0.0 1302 16 0.0 1302 17 0.0 1302 18 0.0 1302 19 0.0 1302 20 0.0 1302 21 0.0 1302 22 0.0 1302 23 0.0 1302 24 0.0 1302 25 0.0 1302 26 0.0 1302 27 0.0 1302 28 0.0 1302 29 0.0 1302 30 0.0 1302 31 0.0 1302 32 0.0 1302 33 0.0 1302 34 0.0 1302 35 0.0 1302 36 0.0 1302 37 0.0 1302 38 0.0 1302 39 0.0 1302 40 0.0 1302 41 0.0 1302 42 0.0 1302 43 0.0 1302 44 0.0 1302 45 0.0 1302 46 0.0 1302 47 0.0 1302 48 0.0 1302 49 0.0 1302 50 0.0 1302 51 0.0 1302 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 1.0 16 0.0 17 1.0 18 2.0 19 1.0 20 4.0 21 4.0 22 7.0 23 4.0 24 16.0 25 16.0 26 22.0 27 18.0 28 28.0 29 41.0 30 50.0 31 66.0 32 91.0 33 118.0 34 134.0 35 171.0 36 268.0 37 382.0 38 715.0 39 1830.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.196540486337426 11.882677362747556 5.966407620957633 37.954374529957384 2 20.925 15.2 36.675000000000004 27.200000000000003 3 18.75 18.675 25.7 36.875 4 25.624999999999996 27.950000000000003 21.925 24.5 5 23.775 31.624999999999996 23.225 21.375 6 20.75 30.5 25.474999999999998 23.275000000000002 7 17.575 19.7 39.7 23.025000000000002 8 17.724999999999998 19.525000000000002 30.975 31.775 9 18.875 19.475 31.225 30.425 10 20.849999999999998 34.75 22.55 21.85 11 25.2 23.75 19.6 31.45 12 24.474999999999998 19.925 24.725 30.875000000000004 13 19.725 24.45 27.6 28.225 14 21.5 24.349999999999998 27.375 26.775 15 22.650000000000002 22.825 26.025 28.499999999999996 16 24.224999999999998 22.650000000000002 25.575 27.55 17 23.799999999999997 23.05 26.275 26.875 18 23.0 23.25 25.674999999999997 28.075 19 22.45 24.125 25.174999999999997 28.249999999999996 20 22.725 24.075 27.125 26.075 21 23.625 22.675 25.45 28.249999999999996 22 22.575 23.425 25.224999999999998 28.775000000000002 23 23.525 22.975 23.9 29.599999999999998 24 21.75 24.099999999999998 26.150000000000002 28.000000000000004 25 23.575 23.3 26.174999999999997 26.950000000000003 26 22.900000000000002 22.725 25.55 28.825 27 21.975 22.2 27.6 28.225 28 24.275 23.875 23.9 27.950000000000003 29 23.474999999999998 23.7 26.075 26.75 30 21.825 23.825 26.474999999999998 27.875 31 23.425 23.95 24.825 27.800000000000004 32 24.275 21.9 26.200000000000003 27.625 33 22.35 21.975 27.150000000000002 28.525 34 23.275000000000002 23.549999999999997 25.25 27.925 35 23.599999999999998 22.925 25.174999999999997 28.299999999999997 36 22.55 23.9 25.874999999999996 27.675 37 23.25 23.05 24.875 28.825 38 23.825 21.6 25.275 29.299999999999997 39 22.5 22.1 25.5 29.9 40 23.5 23.1 24.2 29.2 41 22.6 23.799999999999997 24.9 28.7 42 23.724999999999998 23.400000000000002 25.5 27.375 43 24.75 22.05 25.15 28.050000000000004 44 24.224999999999998 23.1 26.375 26.3 45 23.599999999999998 23.05 25.35 28.000000000000004 46 24.725 22.975 25.525 26.775 47 25.4 22.35 25.124999999999996 27.125 48 24.099999999999998 21.75 24.525 29.625 49 23.25 23.575 25.525 27.650000000000002 50 22.900000000000002 23.075000000000003 25.074999999999996 28.95 51 23.549999999999997 22.275 24.3 29.875 52 23.7 22.125 24.349999999999998 29.825000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 3.0 23 3.0 24 4.0 25 5.0 26 5.5 27 6.0 28 14.5 29 23.0 30 25.5 31 28.0 32 27.5 33 27.0 34 42.5 35 58.0 36 72.0 37 86.0 38 91.0 39 120.0 40 144.0 41 174.0 42 204.0 43 221.5 44 239.0 45 256.5 46 274.0 47 302.0 48 330.0 49 336.5 50 343.0 51 362.0 52 381.0 53 382.0 54 383.0 55 380.0 56 377.0 57 328.0 58 279.0 59 247.0 60 215.0 61 180.0 62 145.0 63 113.5 64 82.5 65 83.0 66 61.0 67 39.0 68 38.0 69 37.0 70 36.5 71 36.0 72 31.5 73 27.0 74 24.0 75 21.0 76 18.0 77 15.0 78 10.0 79 5.0 80 4.5 81 4.0 82 2.5 83 1.0 84 0.5 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.875 #Duplication Level Percentage of deduplicated Percentage of total 1 92.60196905766526 82.3 2 4.6694796061884665 8.3 3 1.4908579465541492 3.975 4 0.7594936708860759 2.7 5 0.14064697609001406 0.625 6 0.19690576652601968 1.05 7 0.0 0.0 8 0.08438818565400844 0.6 9 0.05625879043600562 0.44999999999999996 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 9 0.22499999999999998 No Hit GCCGCAGGCTCCACTCCTGGTGGTGCCCTTCCGTCAATTCCTTTAAGTTTCA 9 0.22499999999999998 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 8 0.2 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCA 8 0.2 No Hit GTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCGAAG 8 0.2 No Hit GTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCAAA 6 0.15 No Hit GCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGG 6 0.15 No Hit GGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCCGCACTTGGCTACC 6 0.15 No Hit GTCGGTTTCGGGTACAGGTACCCTTTTGTTGAAGGTCGTTCGAGCTTTTCCT 6 0.15 No Hit GTCAATTCCTTTGAGTTTCATTCTTGCGAACGTACTCCCCAGGCGGGATACT 6 0.15 No Hit GTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 6 0.15 No Hit GCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACCGGAGGCACGAC 6 0.15 No Hit GGCCATTGTAGCACGTGTGTCGCCCAGGGCATAAGGGGCATGATGACTTGAC 5 0.125 No Hit CGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTG 5 0.125 No Hit GTCAGGATTGGGTAATTTGCGCGCCTGCTGCCTTCCTTGGATGTGGTAGCCG 5 0.125 No Hit CCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACC 5 0.125 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra Read 200000 spots for SRR5423538.sra Written 200000 spots for SRR5423538.sra SRR ids: ['SRR5423538.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_4co_olck SRR5423538.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423538 file size 703961 SRR5423538 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423538 SRR5423538_1.fastq Input file: SRR5423538_1.fastq trimmed: SRR5423538-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:28:47 2025 >> started Wed Feb 12 17:28:49 2025 >> done (1.987s) 4000000 reads processed; of these: 260 ( 0.01%) short reads filtered out after trimming by size control 137 ( 0.00%) empty reads filtered out after trimming by size control 3999603 (99.99%) reads available; of these: 96008 ( 2.40%) trimmed reads available after processing 3903595 (97.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 9 0.00% 20 12 0.00% 21 1 0.00% 22 0 0.00% 23 10 0.00% 24 10 0.00% 25 25 0.00% 26 21 0.00% 27 20 0.00% 28 45 0.00% 29 50 0.00% 30 52 0.00% 31 77 0.00% 32 172 0.00% 33 181 0.00% 34 127 0.00% 35 111 0.00% 36 180 0.00% 37 282 0.01% 38 225 0.01% 39 285 0.01% 40 386 0.01% 41 513 0.01% 42 488 0.01% 43 682 0.02% 44 828 0.02% 45 1702 0.04% 46 2464 0.06% 47 2580 0.06% 48 3107 0.08% 49 5855 0.15% 50 12188 0.30% 51 63310 1.58% 52 3903595 97.60% 3999603 reads passed initial QC criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=33 prefix-density=0.59 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=13.01 fanout-score-rank=1 prefix-density=0.52 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 12 17:29:02 Started mapping on | Feb 12 17:29:02 Finished on | Feb 12 17:29:10 Mapping speed, Million of reads per hour | 1799.82 Number of input reads | 3999603 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2711997 Uniquely mapped reads % | 67.81% Average mapped length | 51.82 Number of splices: Total | 318123 Number of splices: Annotated (sjdb) | 314075 Number of splices: GT/AG | 311473 Number of splices: GC/AG | 6097 Number of splices: AT/AC | 188 Number of splices: Non-canonical | 365 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274342 % of reads mapped to multiple loci | 6.86% Number of reads mapped to too many loci | 994088 % of reads mapped to too many loci | 24.85% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.48% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1013264 1013264 1013264 N_multimapping 274342 274342 274342 N_noFeature 406858 2646915 421791 N_ambiguous 60973 27 10814 UnstrandedReadsAssigned:2244166 PositiveStrandReadsAssigned:65055 NegativeStrandReadsAssigned:2279392 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423538 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423538-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,603 reads, 2,971,191 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR5423538.ke.tsv 34699 SRR5423538.se.tsv 87100 total ==> SRR5423538.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 71 12.3574 Potri.005G024800.1.v4.1 1035 936 15 5.35254 Potri.004G059700.1.v4.1 961 862 11 4.26216 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 34.5339 4.05565 Potri.016G087400.1.v4.1 270 171 81 158.21 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199521 Potri.012G127500.1.v4.1 977 878 38 14.4555 ==> SRR5423538.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 43 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423538 completed mapping pipeline successfully