Starting /dee2/code/volunteer_pipeline.sh SRR5423540 current disk space = 3051736436736 free memory = 1568465352 SRR5423540 SRAfilesize b6122d9514514346e4af12b1d99bee26 SRR5423540.sra SRR5423540.sra file validated SRR5423540 is single end SRR5423540 is conventional basespace SRR5423540 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423540_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.46025 34.0 31.0 34.0 31.0 34.0 2 32.60575 34.0 31.0 34.0 31.0 34.0 3 32.69975 34.0 31.0 34.0 31.0 34.0 4 36.1045 37.0 35.0 37.0 35.0 37.0 5 36.0805 37.0 35.0 37.0 35.0 37.0 6 35.94725 37.0 35.0 37.0 35.0 37.0 7 36.02575 37.0 35.0 37.0 35.0 37.0 8 36.08925 37.0 35.0 37.0 35.0 37.0 9 37.70075 39.0 37.0 39.0 35.0 39.0 10 37.68025 39.0 38.0 39.0 35.0 39.0 11 37.73175 39.0 38.0 39.0 35.0 39.0 12 37.72825 39.0 38.0 39.0 35.0 39.0 13 37.60275 39.0 37.0 39.0 35.0 39.0 14 39.13 40.0 39.0 41.0 36.0 41.0 15 39.1255 40.0 39.0 41.0 36.0 41.0 16 38.97175 40.0 38.0 41.0 36.0 41.0 17 39.0365 40.0 38.0 41.0 36.0 41.0 18 39.02825 40.0 38.0 41.0 36.0 41.0 19 39.00775 40.0 39.0 41.0 36.0 41.0 20 39.0145 40.0 38.0 41.0 35.0 41.0 21 38.9305 40.0 38.0 41.0 35.0 41.0 22 38.98925 40.0 39.0 41.0 35.0 41.0 23 38.85925 40.0 38.0 41.0 35.0 41.0 24 38.82175 40.0 38.0 41.0 35.0 41.0 25 38.8325 40.0 38.0 41.0 35.0 41.0 26 38.684 40.0 38.0 41.0 34.0 41.0 27 38.67025 40.0 38.0 41.0 34.0 41.0 28 38.638 40.0 38.0 41.0 34.0 41.0 29 38.54125 40.0 38.0 41.0 34.0 41.0 30 38.62075 40.0 38.0 41.0 34.0 41.0 31 38.5485 40.0 38.0 41.0 34.0 41.0 32 38.403 40.0 38.0 41.0 34.0 41.0 33 38.46825 40.0 38.0 41.0 34.0 41.0 34 38.41225 40.0 38.0 41.0 34.0 41.0 35 38.5065 40.0 38.0 41.0 34.0 41.0 36 38.309 40.0 38.0 41.0 34.0 41.0 37 38.10625 40.0 38.0 41.0 33.0 41.0 38 38.13875 40.0 38.0 41.0 34.0 41.0 39 37.8695 40.0 37.0 41.0 33.0 41.0 40 37.9355 40.0 37.0 41.0 33.0 41.0 41 37.72175 40.0 37.0 41.0 32.0 41.0 42 37.68475 40.0 37.0 41.0 33.0 41.0 43 37.667 40.0 37.0 41.0 33.0 41.0 44 37.57525 40.0 37.0 41.0 33.0 41.0 45 37.273 40.0 36.0 41.0 31.0 41.0 46 37.322 40.0 36.0 41.0 31.0 41.0 47 37.35675 40.0 36.0 41.0 32.0 41.0 48 37.15675 39.0 36.0 41.0 31.0 41.0 49 37.2305 39.0 36.0 41.0 32.0 41.0 50 37.118 39.0 36.0 41.0 31.0 41.0 51 37.13425 39.0 35.0 41.0 31.0 41.0 52 36.05425 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2108 1 0.0 2108 2 0.0 2108 3 0.0 2108 4 0.0 2108 5 0.0 2108 6 0.0 2108 7 0.0 2108 8 0.0 2108 9 0.0 2108 10 0.0 2108 11 0.0 2108 12 0.0 2108 13 0.0 2108 14 0.0 2108 15 0.0 2108 16 0.0 2108 17 0.0 2108 18 0.0 2108 19 0.0 2108 20 0.0 2108 21 0.0 2108 22 0.0 2108 23 0.0 2108 24 0.0 2108 25 0.0 2108 26 0.0 2108 27 0.0 2108 28 0.0 2108 29 0.0 2108 30 0.0 2108 31 0.0 2108 32 0.0 2108 33 0.0 2108 34 0.0 2108 35 0.0 2108 36 0.0 2108 37 0.0 2108 38 0.0 2108 39 0.0 2108 40 0.0 2108 41 0.0 2108 42 0.0 2108 43 0.0 2108 44 0.0 2108 45 0.0 2108 46 0.0 2108 47 0.0 2108 48 0.0 2108 49 0.0 2108 50 0.0 2108 51 0.0 2108 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 1.0 21 5.0 22 4.0 23 4.0 24 9.0 25 6.0 26 18.0 27 25.0 28 17.0 29 41.0 30 39.0 31 55.0 32 79.0 33 117.0 34 131.0 35 210.0 36 277.0 37 407.0 38 755.0 39 1785.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.51642839227489 12.089290193127665 5.8690744920993225 38.525206922498114 2 23.05 14.799999999999999 34.625 27.525 3 19.85 19.625 25.5 35.025 4 25.2 27.975 21.375 25.45 5 23.375 32.65 23.200000000000003 20.775 6 21.775 30.275000000000002 25.025 22.925 7 17.275 18.65 41.775 22.3 8 18.6 19.325 30.625000000000004 31.45 9 20.349999999999998 18.175 32.45 29.025000000000002 10 21.125 33.45 22.2 23.225 11 25.75 22.3 20.65 31.3 12 23.200000000000003 20.9 24.6 31.3 13 21.2 24.575 28.775000000000002 25.45 14 22.975 23.674999999999997 25.674999999999997 27.675 15 22.3 23.25 25.974999999999998 28.475 16 22.900000000000002 23.95 24.775 28.375 17 23.0 22.925 26.55 27.525 18 24.525 22.425 25.5 27.55 19 24.099999999999998 22.7 25.15 28.050000000000004 20 22.6 22.275 26.700000000000003 28.425 21 23.525 23.1 26.75 26.625 22 23.9 23.375 24.45 28.275 23 23.125 23.1 24.8 28.975 24 22.675 22.925 25.174999999999997 29.225 25 23.674999999999997 22.45 25.25 28.625 26 21.925 22.125 27.775 28.175 27 23.175 22.45 25.525 28.849999999999998 28 23.075000000000003 23.75 25.424999999999997 27.750000000000004 29 23.65 22.775000000000002 25.874999999999996 27.700000000000003 30 23.05 22.575 25.074999999999996 29.299999999999997 31 22.875 23.325000000000003 26.125 27.675 32 23.825 21.6 25.75 28.825 33 22.5 22.575 26.35 28.575 34 22.75 22.6 25.95 28.7 35 23.325000000000003 23.724999999999998 25.6 27.35 36 23.45 21.875 25.025 29.65 37 23.375 23.325000000000003 26.075 27.224999999999998 38 24.15 21.325 25.4 29.125 39 21.224999999999998 23.525 25.525 29.725 40 24.875 23.025000000000002 24.2 27.900000000000002 41 24.25 23.974999999999998 24.474999999999998 27.3 42 24.474999999999998 22.95 25.724999999999998 26.85 43 25.324999999999996 22.5 26.924999999999997 25.25 44 23.95 23.150000000000002 25.775 27.125 45 23.275000000000002 23.1 25.4 28.225 46 23.3 22.875 25.374999999999996 28.449999999999996 47 23.575 23.150000000000002 24.05 29.225 48 22.825 23.575 23.65 29.95 49 23.599999999999998 22.075 24.675 29.65 50 22.375 23.625 25.25 28.749999999999996 51 22.95 22.375 25.25 29.425 52 23.65 22.2 24.65 29.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.5 23 3.0 24 4.0 25 5.0 26 5.0 27 5.0 28 12.5 29 20.0 30 24.5 31 29.0 32 31.0 33 33.0 34 36.5 35 40.0 36 60.5 37 81.0 38 89.5 39 123.0 40 148.0 41 162.0 42 176.0 43 213.0 44 250.0 45 267.0 46 284.0 47 308.5 48 333.0 49 340.0 50 347.0 51 366.0 52 385.0 53 384.5 54 384.0 55 363.5 56 343.0 57 323.5 58 304.0 59 250.0 60 196.0 61 173.5 62 151.0 63 115.5 64 84.0 65 88.0 66 72.0 67 56.0 68 54.5 69 53.0 70 47.0 71 41.0 72 37.0 73 33.0 74 27.0 75 21.0 76 12.0 77 3.0 78 4.0 79 5.0 80 3.5 81 2.0 82 1.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.14023183488833 81.475 2 5.060785976816511 8.95 3 1.583262651964942 4.2 4 0.5654509471303365 2.0 5 0.4240882103477523 1.875 6 0.11309018942606729 0.6 7 0.08481764206955046 0.525 8 0.0 0.0 9 0.0 0.0 >10 0.02827254735651682 0.375 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 15 0.375 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 7 0.17500000000000002 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 7 0.17500000000000002 No Hit GGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCCC 6 0.15 No Hit CTCAAACTTCCTTGGCCTGGAAGGCCATAGTCCCTCTAAGAAGCTGGCCGCG 6 0.15 No Hit GCTACTACCACCAAGATCTGCACCGACGGCCGCTCCGCCCGGGCTCGCGCCC 6 0.15 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCC 6 0.15 No Hit ATCACGATGAAATTTCAAAGATTACCCGGGCCTGTCGGCCAAGGCTATAGAC 5 0.125 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 5 0.125 No Hit GCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGG 5 0.125 No Hit CCGCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAG 5 0.125 No Hit CCTAGATGTCCAGTCAACTGCTGCGCCTCAACGCATTTCGGGGAGAACCAGC 5 0.125 No Hit GTCCTGCTGTCTTAATCGACCAACACCCTTTGTGGGTTCTAGGTTAGCGCGC 5 0.125 No Hit CCAGAGCGTAGGCTTGCTTTGAGCACTCTAATTTCTTCAAAGTAACAGCACC 5 0.125 No Hit GTCGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACT 5 0.125 No Hit GCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGAC 5 0.125 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCT 5 0.125 No Hit CTCTAAGAAGCTGGCCGCGGAGGGTCACCTCCGCATAGCTAGTTAGCAGGCT 5 0.125 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 5 0.125 No Hit GGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGG 5 0.125 No Hit GTCCGTACCAGTTCTGAGTCGACTGTTCGACGCCCGGGGAAGGCCCCCGAAG 5 0.125 No Hit CCGGCTTCCGGTTCATCCCGCATCGCCAGTTCTGCTTACCAAAAATGGCCCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra Read 200000 spots for SRR5423540.sra Written 200000 spots for SRR5423540.sra SRR ids: ['SRR5423540.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0btro2qr SRR5423540.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423540 file size 703991 SRR5423540 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423540 SRR5423540_1.fastq Input file: SRR5423540_1.fastq trimmed: SRR5423540-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:31:41 2025 >> started Wed Feb 12 17:31:43 2025 >> done (2.587s) 4000000 reads processed; of these: 291 ( 0.01%) short reads filtered out after trimming by size control 151 ( 0.00%) empty reads filtered out after trimming by size control 3999558 (99.99%) reads available; of these: 89923 ( 2.25%) trimmed reads available after processing 3909635 (97.75%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 9 0.00% 20 12 0.00% 21 3 0.00% 22 6 0.00% 23 8 0.00% 24 22 0.00% 25 35 0.00% 26 59 0.00% 27 48 0.00% 28 88 0.00% 29 95 0.00% 30 80 0.00% 31 128 0.00% 32 192 0.00% 33 204 0.01% 34 177 0.00% 35 157 0.00% 36 174 0.00% 37 213 0.01% 38 239 0.01% 39 271 0.01% 40 323 0.01% 41 351 0.01% 42 473 0.01% 43 610 0.02% 44 781 0.02% 45 1131 0.03% 46 1720 0.04% 47 2003 0.05% 48 2809 0.07% 49 5651 0.14% 50 12138 0.30% 51 59699 1.49% 52 3909635 97.75% 3999558 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=33 prefix-density=0.59 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=20.47 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 12 17:31:53 Started mapping on | Feb 12 17:31:54 Finished on | Feb 12 17:32:05 Mapping speed, Million of reads per hour | 1308.95 Number of input reads | 3999558 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2711443 Uniquely mapped reads % | 67.79% Average mapped length | 51.81 Number of splices: Total | 318039 Number of splices: Annotated (sjdb) | 314102 Number of splices: GT/AG | 311298 Number of splices: GC/AG | 6196 Number of splices: AT/AC | 179 Number of splices: Non-canonical | 366 Mismatch rate per base, % | 0.50% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275333 % of reads mapped to multiple loci | 6.88% Number of reads mapped to too many loci | 992749 % of reads mapped to too many loci | 24.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.50% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1012782 1012782 1012782 N_multimapping 275333 275333 275333 N_noFeature 407409 2646259 422359 N_ambiguous 60866 27 10618 UnstrandedReadsAssigned:2243168 PositiveStrandReadsAssigned:65157 NegativeStrandReadsAssigned:2278466 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423540 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423540-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,558 reads, 2,962,136 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,048 rounds 52401 SRR5423540.ke.tsv 34699 SRR5423540.se.tsv 87100 total ==> SRR5423540.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 64 11.1868 Potri.005G024800.1.v4.1 1035 936 9 3.22529 Potri.004G059700.1.v4.1 961 862 9 3.50217 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 30 3.53829 Potri.016G087400.1.v4.1 270 171 74 145.157 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 44 16.8097 ==> SRR5423540.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR5423540 completed mapping pipeline successfully