Starting /dee2/code/volunteer_pipeline.sh SRR5423542 current disk space = 3051730956288 free memory = 1578195772 SRR5423542 SRAfilesize d87b170a0faf46f9850a236ad822321d SRR5423542.sra SRR5423542.sra file validated SRR5423542 is single end SRR5423542 is conventional basespace SRR5423542 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423542_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.383 31.0 31.0 34.0 28.0 34.0 2 31.8215 33.0 31.0 34.0 30.0 34.0 3 32.0025 33.0 31.0 34.0 30.0 34.0 4 32.83575 35.0 33.0 37.0 19.0 37.0 5 34.74275 37.0 35.0 37.0 30.0 37.0 6 35.151 37.0 35.0 37.0 32.0 37.0 7 35.46575 37.0 35.0 37.0 33.0 37.0 8 35.62325 37.0 35.0 37.0 33.0 37.0 9 37.2555 39.0 37.0 39.0 34.0 39.0 10 37.12875 39.0 37.0 39.0 33.0 39.0 11 37.36225 39.0 37.0 39.0 34.0 39.0 12 37.363 39.0 37.0 39.0 34.0 39.0 13 37.2155 39.0 37.0 39.0 33.0 39.0 14 38.267 40.0 38.0 41.0 33.0 41.0 15 38.406 40.0 38.0 41.0 34.0 41.0 16 38.35875 40.0 38.0 41.0 33.0 41.0 17 38.30775 40.0 38.0 41.0 33.0 41.0 18 38.093 40.0 37.0 41.0 33.0 41.0 19 38.39 40.0 38.0 41.0 34.0 41.0 20 38.28725 40.0 38.0 41.0 34.0 41.0 21 38.40225 40.0 38.0 41.0 34.0 41.0 22 38.41275 40.0 38.0 41.0 34.0 41.0 23 38.372 40.0 38.0 41.0 34.0 41.0 24 38.138 40.0 38.0 41.0 33.0 41.0 25 38.25525 40.0 38.0 41.0 34.0 41.0 26 38.12675 40.0 38.0 41.0 33.0 41.0 27 38.10575 40.0 38.0 41.0 33.0 41.0 28 38.12975 40.0 38.0 41.0 33.0 41.0 29 37.953 40.0 37.0 41.0 33.0 41.0 30 37.943 40.0 37.0 41.0 33.0 41.0 31 37.95525 40.0 37.0 41.0 33.0 41.0 32 37.91725 40.0 37.0 41.0 33.0 41.0 33 37.8425 40.0 37.0 41.0 33.0 41.0 34 37.987 40.0 37.0 41.0 33.0 41.0 35 37.82375 40.0 37.0 41.0 32.0 41.0 36 37.69525 40.0 37.0 41.0 32.0 41.0 37 37.737 40.0 37.0 41.0 32.0 41.0 38 37.589 40.0 37.0 41.0 32.0 41.0 39 37.055 40.0 36.0 41.0 31.0 41.0 40 37.33925 40.0 36.0 41.0 31.0 41.0 41 37.25725 39.0 36.0 41.0 31.0 41.0 42 37.00475 39.0 36.0 41.0 31.0 41.0 43 37.2245 39.0 36.0 41.0 31.0 41.0 44 37.03975 39.0 35.0 41.0 31.0 41.0 45 37.036 39.0 36.0 41.0 31.0 41.0 46 36.91825 39.0 35.0 41.0 31.0 41.0 47 36.75825 39.0 35.0 41.0 30.0 41.0 48 36.52575 39.0 35.0 40.0 30.0 41.0 49 36.6885 39.0 35.0 40.0 30.0 41.0 50 36.6605 39.0 35.0 40.0 30.0 41.0 51 36.48725 39.0 35.0 40.0 30.0 41.0 52 35.72275 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2214 1 0.0 2214 2 0.0 2214 3 0.0 2214 4 0.0 2214 5 0.0 2214 6 0.0 2214 7 0.0 2214 8 0.0 2214 9 0.0 2214 10 0.0 2214 11 0.0 2214 12 0.0 2214 13 0.0 2214 14 0.0 2214 15 0.0 2214 16 0.0 2214 17 0.0 2214 18 0.0 2214 19 0.0 2214 20 0.0 2214 21 0.0 2214 22 0.0 2214 23 0.0 2214 24 0.0 2214 25 0.0 2214 26 0.0 2214 27 0.0 2214 28 0.0 2214 29 0.0 2214 30 0.0 2214 31 0.0 2214 32 0.0 2214 33 0.0 2214 34 0.0 2214 35 0.0 2214 36 0.0 2214 37 0.0 2214 38 0.0 2214 39 0.0 2214 40 0.0 2214 41 0.0 2214 42 0.0 2214 43 0.0 2214 44 0.0 2214 45 0.0 2214 46 0.0 2214 47 0.0 2214 48 0.0 2214 49 0.0 2214 50 0.0 2214 51 0.0 2214 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 3.0 20 0.0 21 2.0 22 1.0 23 5.0 24 13.0 25 9.0 26 19.0 27 26.0 28 46.0 29 49.0 30 69.0 31 95.0 32 126.0 33 133.0 34 190.0 35 284.0 36 348.0 37 508.0 38 759.0 39 1312.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.36836836836837 12.362362362362363 6.281281281281281 37.987987987987985 2 23.25 15.299999999999999 34.300000000000004 27.150000000000002 3 20.275000000000002 19.6 25.6 34.525 4 23.474999999999998 27.525 24.15 24.85 5 24.55 30.8 23.525 21.125 6 21.625 29.975 24.4 24.0 7 17.424999999999997 18.65 42.05 21.875 8 18.4 18.65 30.575000000000003 32.375 9 19.525000000000002 18.575 31.5 30.4 10 21.075 33.15 22.650000000000002 23.125 11 25.2 22.925 19.950000000000003 31.924999999999997 12 22.25 20.225 26.525 31.0 13 22.475 22.400000000000002 28.1 27.025 14 21.625 23.674999999999997 27.025 27.675 15 23.525 24.0 25.324999999999996 27.150000000000002 16 25.424999999999997 23.45 23.025000000000002 28.1 17 23.3 23.200000000000003 24.625 28.875 18 22.0 23.175 24.975 29.849999999999998 19 24.3 24.25 24.775 26.674999999999997 20 23.075000000000003 24.2 26.6 26.125 21 22.35 23.125 25.874999999999996 28.65 22 23.200000000000003 23.0 25.95 27.85 23 22.375 22.675 25.15 29.799999999999997 24 22.7 23.275000000000002 26.150000000000002 27.875 25 24.15 22.7 25.05 28.1 26 23.724999999999998 21.65 24.775 29.849999999999998 27 22.85 22.5 26.325 28.325 28 22.8 23.875 24.8 28.525 29 23.200000000000003 22.85 25.15 28.799999999999997 30 22.675 22.0 27.1 28.225 31 22.275 24.0 25.900000000000002 27.825 32 23.45 22.55 27.125 26.875 33 22.725 21.349999999999998 25.775 30.15 34 21.3 24.675 25.45 28.575 35 22.6 23.5 26.775 27.125 36 22.55 22.6 25.85 28.999999999999996 37 23.125 23.400000000000002 26.0 27.474999999999998 38 24.425 23.225 24.349999999999998 28.000000000000004 39 23.25 23.25 24.65 28.849999999999998 40 23.95 23.974999999999998 23.400000000000002 28.675 41 23.05 24.275 25.874999999999996 26.8 42 24.325 23.075000000000003 25.2 27.400000000000002 43 23.525 22.375 26.075 28.025 44 23.775 22.35 27.6 26.275 45 25.0 21.125 24.95 28.925 46 24.6 23.549999999999997 24.825 27.025 47 24.975 21.975 25.2 27.85 48 23.674999999999997 23.125 24.15 29.049999999999997 49 24.2 23.974999999999998 23.925 27.900000000000002 50 24.875 22.025 25.4 27.700000000000003 51 22.8 22.275 26.0 28.925 52 23.5 23.125 24.975 28.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 3.0 22 4.0 23 5.0 24 4.0 25 3.0 26 4.5 27 6.0 28 10.0 29 14.0 30 20.0 31 26.0 32 30.0 33 34.0 34 40.0 35 46.0 36 56.5 37 67.0 38 94.5 39 119.5 40 117.0 41 162.5 42 208.0 43 217.0 44 226.0 45 239.0 46 252.0 47 303.5 48 355.0 49 357.0 50 359.0 51 390.0 52 421.0 53 402.5 54 384.0 55 370.5 56 357.0 57 324.0 58 291.0 59 238.5 60 186.0 61 171.0 62 156.0 63 119.0 64 86.5 65 91.0 66 67.5 67 44.0 68 47.0 69 50.0 70 42.0 71 34.0 72 33.5 73 33.0 74 24.5 75 16.0 76 10.0 77 4.0 78 3.5 79 3.0 80 2.5 81 2.0 82 2.0 83 2.0 84 1.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.0 #Duplication Level Percentage of deduplicated Percentage of total 1 93.1388888888889 83.825 2 4.527777777777778 8.15 3 1.3333333333333335 3.5999999999999996 4 0.5833333333333334 2.1 5 0.19444444444444445 0.8750000000000001 6 0.05555555555555555 0.3 7 0.08333333333333334 0.525 8 0.05555555555555555 0.4 9 0.027777777777777776 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 9 0.22499999999999998 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 8 0.2 No Hit GCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGC 8 0.2 No Hit CTCAAACTTCCTTGGCCTGGAAGGCCATAGTCCCTCTAAGAAGCTGGCCGCG 7 0.17500000000000002 No Hit GTCAGTATCGCTGCGGGCCTCCACCAGAGTTTCCTCTGGCTTCGCCCCGCTC 7 0.17500000000000002 No Hit GGGAATTGTACTTCAAGGCGGCCCGCGCGGCTCTTTCACCGCGAGGGCTTGG 7 0.17500000000000002 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 6 0.15 No Hit GGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCC 6 0.15 No Hit GTTGAAGACCAACAATTGCAATGATCTATCCCCATCACGATGAAATTTCAAA 5 0.125 No Hit CCGGAATCGAACCCTAATTCTCCGTCACCCGTCACCACCATGGTAGGCCTCT 5 0.125 No Hit GCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGAC 5 0.125 No Hit GTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATGCGGTTATGAGTA 5 0.125 No Hit CTTTTGTTCCACACGAGATTTCTGTTCTCGTTGAGCTCATCTTAGGACACCT 5 0.125 No Hit CGATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAA 5 0.125 No Hit GTTCAGTCATAATCCAACGCACGGTAGCTTCGCGCCACTGGCTTTTCAACCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.075 0.0 0.0 0.0 0.0 40 0.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra Read 200000 spots for SRR5423542.sra Written 200000 spots for SRR5423542.sra SRR ids: ['SRR5423542.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_njd4qwul SRR5423542.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423542 file size 703955 SRR5423542 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423542 SRR5423542_1.fastq Input file: SRR5423542_1.fastq trimmed: SRR5423542-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:29:50 2025 >> started Wed Feb 12 17:29:53 2025 >> done (2.649s) 4000000 reads processed; of these: 296 ( 0.01%) short reads filtered out after trimming by size control 138 ( 0.00%) empty reads filtered out after trimming by size control 3999566 (99.99%) reads available; of these: 108434 ( 2.71%) trimmed reads available after processing 3891132 (97.29%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 6 0.00% 20 20 0.00% 21 2 0.00% 22 6 0.00% 23 14 0.00% 24 20 0.00% 25 38 0.00% 26 38 0.00% 27 67 0.00% 28 71 0.00% 29 94 0.00% 30 116 0.00% 31 148 0.00% 32 232 0.01% 33 223 0.01% 34 185 0.00% 35 209 0.01% 36 252 0.01% 37 392 0.01% 38 375 0.01% 39 352 0.01% 40 576 0.01% 41 723 0.02% 42 762 0.02% 43 924 0.02% 44 1173 0.03% 45 2115 0.05% 46 2996 0.07% 47 3075 0.08% 48 4006 0.10% 49 7023 0.18% 50 14488 0.36% 51 67701 1.69% 52 3891132 97.29% 3999566 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=31 prefix-density=0.56 prefix-fanout=1.9 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=17 fanout-score=13.02 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=2.2 sequence=CGCATCGCCGGCCCCCATCCACTTCCCTCCCGACAATTTCAAGCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACTTGTTTGCTATCGGTCTCTCGCCCGTATTTAGCCT Started job on | Feb 12 17:30:07 Started mapping on | Feb 12 17:30:08 Finished on | Feb 12 17:30:15 Mapping speed, Million of reads per hour | 2056.92 Number of input reads | 3999566 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2718101 Uniquely mapped reads % | 67.96% Average mapped length | 51.82 Number of splices: Total | 319673 Number of splices: Annotated (sjdb) | 315704 Number of splices: GT/AG | 313016 Number of splices: GC/AG | 6090 Number of splices: AT/AC | 211 Number of splices: Non-canonical | 356 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275436 % of reads mapped to multiple loci | 6.89% Number of reads mapped to too many loci | 982676 % of reads mapped to too many loci | 24.57% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.58% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1006029 1006029 1006029 N_multimapping 275436 275436 275436 N_noFeature 406141 2652652 421296 N_ambiguous 61112 39 10800 UnstrandedReadsAssigned:2250848 PositiveStrandReadsAssigned:65410 NegativeStrandReadsAssigned:2286005 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423542 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423542-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,566 reads, 2,960,628 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR5423542.ke.tsv 34699 SRR5423542.se.tsv 87100 total ==> SRR5423542.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 54 9.41774 Potri.005G024800.1.v4.1 1035 936 12.0175 4.29702 Potri.004G059700.1.v4.1 961 862 6 2.32955 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 25 2.94197 Potri.016G087400.1.v4.1 270 171 81 158.532 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.199927 Potri.012G127500.1.v4.1 977 878 32 12.1979 ==> SRR5423542.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR5423542 completed mapping pipeline successfully