Starting /dee2/code/volunteer_pipeline.sh SRR5423543 current disk space = 3091073052672 free memory = 1447369708 SRR5423543 SRAfilesize c6336fb0d34e79f6c87cf6f47a10aeac SRR5423543.sra SRR5423543.sra file validated SRR5423543 is single end SRR5423543 is conventional basespace SRR5423543 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423543_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.11175 33.0 31.0 34.0 30.0 34.0 2 32.2745 34.0 31.0 34.0 30.0 34.0 3 32.39025 34.0 31.0 34.0 30.0 34.0 4 34.934 37.0 35.0 37.0 32.0 37.0 5 35.63275 37.0 35.0 37.0 33.0 37.0 6 35.67375 37.0 35.0 37.0 33.0 37.0 7 35.78625 37.0 35.0 37.0 35.0 37.0 8 35.9205 37.0 35.0 37.0 35.0 37.0 9 37.65125 39.0 37.0 39.0 35.0 39.0 10 37.52925 39.0 37.0 39.0 35.0 39.0 11 37.48475 39.0 37.0 39.0 35.0 39.0 12 37.4245 39.0 37.0 39.0 34.0 39.0 13 37.457 39.0 37.0 39.0 35.0 39.0 14 38.9195 40.0 38.0 41.0 35.0 41.0 15 38.68275 40.0 38.0 41.0 34.0 41.0 16 38.5215 40.0 38.0 41.0 34.0 41.0 17 38.6035 40.0 38.0 41.0 34.0 41.0 18 38.72375 40.0 38.0 41.0 35.0 41.0 19 38.67475 40.0 38.0 41.0 34.0 41.0 20 38.6755 40.0 38.0 41.0 34.0 41.0 21 38.36575 40.0 38.0 41.0 33.0 41.0 22 38.57875 40.0 38.0 41.0 34.0 41.0 23 38.57025 40.0 38.0 41.0 34.0 41.0 24 38.522 40.0 38.0 41.0 34.0 41.0 25 38.517 40.0 38.0 41.0 34.0 41.0 26 38.3825 40.0 38.0 41.0 34.0 41.0 27 38.27625 40.0 38.0 41.0 34.0 41.0 28 38.25275 40.0 38.0 41.0 34.0 41.0 29 38.32625 40.0 38.0 41.0 34.0 41.0 30 38.09275 40.0 38.0 41.0 33.0 41.0 31 38.19625 40.0 38.0 41.0 33.0 41.0 32 38.124 40.0 38.0 41.0 33.0 41.0 33 38.02175 40.0 38.0 41.0 33.0 41.0 34 38.0195 40.0 38.0 41.0 33.0 41.0 35 37.968 40.0 38.0 41.0 33.0 41.0 36 37.9685 40.0 38.0 41.0 33.0 41.0 37 37.84575 40.0 37.0 41.0 33.0 41.0 38 37.81725 40.0 37.0 41.0 33.0 41.0 39 37.6505 40.0 37.0 41.0 33.0 41.0 40 37.607 40.0 37.0 41.0 32.0 41.0 41 37.296 40.0 37.0 41.0 31.0 41.0 42 37.361 40.0 37.0 41.0 31.0 41.0 43 37.24625 40.0 36.0 41.0 31.0 41.0 44 37.05275 40.0 36.0 41.0 31.0 41.0 45 36.92925 39.0 36.0 41.0 30.0 41.0 46 37.155 39.0 36.0 41.0 31.0 41.0 47 37.05125 39.0 36.0 41.0 31.0 41.0 48 36.834 39.0 35.0 41.0 31.0 41.0 49 36.7965 39.0 35.0 41.0 30.0 41.0 50 36.5545 39.0 35.0 41.0 30.0 41.0 51 36.64925 39.0 35.0 41.0 30.0 41.0 52 35.81575 38.0 34.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10 0.0 2309 11 0.0 2309 12 0.0 2309 13 0.0 2309 14 0.0 2309 15 0.0 2309 16 0.0 2309 17 0.0 2309 18 0.0 2309 19 0.0 2309 20 0.0 2309 21 0.0 2309 22 0.0 2309 23 0.0 2309 24 0.0 2309 25 0.0 2309 26 0.0 2309 27 0.0 2309 28 0.0 2309 29 0.0 2309 30 0.0 2309 31 0.0 2309 32 0.0 2309 33 0.0 2309 34 0.0 2309 35 0.0 2309 36 0.0 2309 37 0.0 2309 38 0.0 2309 39 0.0 2309 40 0.0 2309 41 0.0 2309 42 0.0 2309 43 0.0 2309 44 0.0 2309 45 0.0 2309 46 0.0 2309 47 0.0 2309 48 0.0 2309 49 0.0 2309 50 0.0 2309 51 0.0 2309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.0 21 6.0 22 7.0 23 5.0 24 8.0 25 14.0 26 15.0 27 25.0 28 32.0 29 40.0 30 58.0 31 78.0 32 96.0 33 164.0 34 149.0 35 200.0 36 306.0 37 421.0 38 826.0 39 1532.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.475 12.375 6.65 39.5 2 21.7 15.925 34.35 28.025 3 19.575 19.525000000000002 26.5 34.4 4 25.275 27.425 23.275000000000002 24.025 5 22.875 32.125 24.125 20.875 6 21.275 30.2 23.925 24.6 7 16.3 19.575 40.475 23.65 8 18.2 19.725 31.05 31.025000000000002 9 19.55 18.65 32.175 29.625 10 20.674999999999997 32.625 23.925 22.775000000000002 11 24.8 23.9 18.925 32.375 12 24.325 19.5 24.925 31.25 13 21.325 22.650000000000002 28.199999999999996 27.825 14 22.075 23.325000000000003 28.025 26.575 15 21.575 22.475 27.250000000000004 28.7 16 23.1 23.025000000000002 25.35 28.525 17 22.075 24.6 25.324999999999996 28.000000000000004 18 24.05 23.200000000000003 25.4 27.35 19 23.275000000000002 24.7 25.05 26.974999999999998 20 22.325 23.3 26.924999999999997 27.450000000000003 21 22.125 22.75 25.674999999999997 29.45 22 23.599999999999998 23.400000000000002 24.875 28.125 23 23.375 23.175 24.375 29.075 24 22.1 24.0 25.924999999999997 27.975 25 23.425 22.6 26.224999999999998 27.750000000000004 26 21.85 23.275000000000002 25.874999999999996 28.999999999999996 27 22.5 22.45 26.450000000000003 28.599999999999998 28 24.0 22.650000000000002 24.25 29.099999999999998 29 22.825 23.25 25.4 28.525 30 21.4 22.15 27.450000000000003 28.999999999999996 31 23.0 23.200000000000003 25.85 27.950000000000003 32 23.599999999999998 22.375 26.5 27.525 33 22.375 22.125 26.25 29.25 34 22.575 23.375 26.05 28.000000000000004 35 23.5 23.799999999999997 24.474999999999998 28.225 36 22.775000000000002 23.674999999999997 25.224999999999998 28.325 37 22.95 24.8 24.925 27.325 38 23.974999999999998 23.35 23.775 28.9 39 23.375 22.225 24.85 29.549999999999997 40 23.200000000000003 23.150000000000002 23.9 29.75 41 24.7 23.025000000000002 25.474999999999998 26.8 42 24.2 23.35 25.75 26.700000000000003 43 24.9 23.799999999999997 24.45 26.85 44 24.4 23.1 26.275 26.224999999999998 45 22.925 22.8 25.324999999999996 28.95 46 23.275000000000002 23.724999999999998 24.875 28.125 47 23.275000000000002 22.325 26.125 28.275 48 23.125 22.55 24.875 29.45 49 22.675 23.1 25.224999999999998 28.999999999999996 50 22.900000000000002 23.150000000000002 24.675 29.275000000000002 51 23.0 21.85 25.85 29.299999999999997 52 24.675 21.975 24.2 29.15 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 3.0 23 5.0 24 6.0 25 7.0 26 7.5 27 8.0 28 14.0 29 20.0 30 17.0 31 14.0 32 25.0 33 36.0 34 49.5 35 63.0 36 70.0 37 77.0 38 88.5 39 111.0 40 122.0 41 153.5 42 185.0 43 204.5 44 224.0 45 246.5 46 269.0 47 305.0 48 341.0 49 368.0 50 395.0 51 400.0 52 405.0 53 399.0 54 393.0 55 367.5 56 342.0 57 331.0 58 320.0 59 271.5 60 223.0 61 185.0 62 147.0 63 103.5 64 64.5 65 69.0 66 54.0 67 39.0 68 39.0 69 39.0 70 35.5 71 32.0 72 33.5 73 35.0 74 25.5 75 16.0 76 10.0 77 4.0 78 4.0 79 4.0 80 2.5 81 1.0 82 1.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.5 90 1.0 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.4 #Duplication Level Percentage of deduplicated Percentage of total 1 92.42081447963801 81.69999999999999 2 4.722850678733032 8.35 3 1.5271493212669682 4.05 4 0.7070135746606335 2.5 5 0.3393665158371041 1.5 6 0.08484162895927602 0.44999999999999996 7 0.08484162895927602 0.525 8 0.056561085972850686 0.4 9 0.0 0.0 >10 0.056561085972850686 0.525 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGAAACTTCGGAGGGAACCAGCTACTAGACGGTTCGATTAGTCTTTCGCCC 11 0.27499999999999997 No Hit AAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGCGGCCCGCGC 10 0.25 No Hit GATAGAACTCGCACCGAGCTCCAGCTATCCTGAGGGAAACTTCGGAGGGAAC 8 0.2 No Hit GTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAATTGTACTTCAAGGC 8 0.2 No Hit GTCGCGTATTTAAGTCGTCTGCAAAGGATTCTACCCGCCGCTCGGTGGGAAT 7 0.17500000000000002 No Hit GTTGAATACATCAGTGTAGCGCGCGTGCGGCCCAGAACATCTAAGGGCATCA 7 0.17500000000000002 No Hit GCTGATTCCGCCAAGCCCGTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGAC 7 0.17500000000000002 No Hit GTTCCCTTGGCTGTGGTTTCGCTGGATAGTAGACAGGGACAGTGGGAATCTC 6 0.15 No Hit CGGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTA 6 0.15 No Hit CTCCGATTCACGGAATAAGTAAAATAACGTTAAAAGTAGTGGTATTTCACCT 6 0.15 No Hit ATCACGATGAAATTTCAAAGATTACCCGGGCCTGTCGGCCAAGGCTATAGAC 5 0.125 No Hit GGCAATCGGACGGCGGGCGCACGCGTCGCATCTAGCCCGGATTCTGACTTAG 5 0.125 No Hit GCCGACTTCCCTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGG 5 0.125 No Hit GGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCCGCACTTGGCTACC 5 0.125 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 5 0.125 No Hit GGCAGAAATCACATTGCGTGAGCATCCGCAGGGACCATCGCAATGCTTTGTT 5 0.125 No Hit CTCATCTTGGGGTGGGCTTACTACTTAGATGCTTTCAGCAGTTATCCGCTCC 5 0.125 No Hit GTCCCGACAGGCATGCTCTCACTCGAACCCTTCTCAGAAGATCAAGGTCGGT 5 0.125 No Hit CTCCTACTCATCGGGGCCTGGCGCTTGCCCCGACGGCCGGGTATAGGTCGCG 5 0.125 No Hit GCACTCTTTGACTCTCTTTTCAAAGTCCTTTTCATCTTTCCCTCGCGGTACT 5 0.125 No Hit CTCAAGTCATTTCACAAAGTCGGACTAGAGTCAAGCTCAACAGGGTCTTCTT 5 0.125 No Hit CTTGCCTACATTGTTCCATCGACCAGAGGCTGTTCACCTTGGAGACCTGATG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra Read 159089 spots for SRR5423543.sra Written 159089 spots for SRR5423543.sra Read 159081 spots for SRR5423543.sra Written 159081 spots for SRR5423543.sra SRR ids: ['SRR5423543.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xyao69l7 SRR5423543.sra spots: 3181628 blocks: [[1, 159081], [159082, 318162], [318163, 477243], [477244, 636324], [636325, 795405], [795406, 954486], [954487, 1113567], [1113568, 1272648], [1272649, 1431729], [1431730, 1590810], [1590811, 1749891], [1749892, 1908972], [1908973, 2068053], [2068054, 2227134], [2227135, 2386215], [2386216, 2545296], [2545297, 2704377], [2704378, 2863458], [2863459, 3022539], [3022540, 3181628]] SRR5423543 file size 559717 SRR5423543 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423543 SRR5423543_1.fastq Input file: SRR5423543_1.fastq trimmed: SRR5423543-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:17:35 2025 >> started Thu Feb 13 13:17:36 2025 >> done (1.480s) 3181628 reads processed; of these: 207 ( 0.01%) short reads filtered out after trimming by size control 128 ( 0.00%) empty reads filtered out after trimming by size control 3181293 (99.99%) reads available; of these: 60984 ( 1.92%) trimmed reads available after processing 3120309 (98.08%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 5 0.00% 21 0 0.00% 22 1 0.00% 23 5 0.00% 24 6 0.00% 25 11 0.00% 26 10 0.00% 27 5 0.00% 28 6 0.00% 29 11 0.00% 30 19 0.00% 31 23 0.00% 32 38 0.00% 33 74 0.00% 34 65 0.00% 35 49 0.00% 36 68 0.00% 37 52 0.00% 38 94 0.00% 39 126 0.00% 40 110 0.00% 41 95 0.00% 42 178 0.01% 43 179 0.01% 44 249 0.01% 45 513 0.02% 46 928 0.03% 47 963 0.03% 48 1356 0.04% 49 3258 0.10% 50 7775 0.24% 51 44698 1.41% 52 3120309 98.08% 3181293 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.59 prefix-fanout=2.0 sequence=CCGTCAATTCCTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=20.48 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=1.0 sequence=GCCGACATCGAAGGATCAAAAAGCAACGTCGCTATGAACGCTTGGCTGCCACAAGCCAGTTATCCCTGTGGTAACTTTTCTGACACCTCTAGCTTCAAATTCCGAAGGTCTAAAGGATCGATAGGCCACGCTTTCACGGTTCGTATTCGTACTGGAAATCAGAATCAAACGAGCTTTTACCCTTTTGT Started job on | Feb 13 13:17:50 Started mapping on | Feb 13 13:17:50 Finished on | Feb 13 13:17:56 Mapping speed, Million of reads per hour | 1908.78 Number of input reads | 3181293 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 2158125 Uniquely mapped reads % | 67.84% Average mapped length | 51.82 Number of splices: Total | 252709 Number of splices: Annotated (sjdb) | 249621 Number of splices: GT/AG | 247387 Number of splices: GC/AG | 4917 Number of splices: AT/AC | 155 Number of splices: Non-canonical | 250 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 217754 % of reads mapped to multiple loci | 6.84% Number of reads mapped to too many loci | 792152 % of reads mapped to too many loci | 24.90% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.41% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 805414 805414 805414 N_multimapping 217754 217754 217754 N_noFeature 324965 2106800 336739 N_ambiguous 48032 30 8463 UnstrandedReadsAssigned:1785128 PositiveStrandReadsAssigned:51295 NegativeStrandReadsAssigned:1812923 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423543 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423543-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,181,293 reads, 2,364,142 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,058 rounds 52401 SRR5423543.ke.tsv 34699 SRR5423543.se.tsv 87100 total ==> SRR5423543.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 40 8.75966 Potri.005G024800.1.v4.1 1035 936 11 4.93878 Potri.004G059700.1.v4.1 961 862 12 5.85028 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 25 3.69414 Potri.016G087400.1.v4.1 270 171 54 132.709 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.251042 Potri.012G127500.1.v4.1 977 878 24 11.4873 ==> SRR5423543.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 42 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR5423543 completed mapping pipeline successfully