Starting /dee2/code/volunteer_pipeline.sh SRR5423544 current disk space = 3091251068928 free memory = 1475594240 SRR5423544 SRAfilesize 6b8cd0ece01f3ca8d293ac9949c7c0a0 SRR5423544.sra SRR5423544.sra file validated SRR5423544 is single end SRR5423544 is conventional basespace SRR5423544 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423544_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.25475 34.0 31.0 34.0 26.0 34.0 2 31.579 34.0 31.0 34.0 26.0 34.0 3 32.55525 34.0 31.0 34.0 28.0 34.0 4 36.1495 37.0 35.0 37.0 35.0 37.0 5 36.17625 37.0 37.0 37.0 35.0 37.0 6 36.2605 37.0 37.0 37.0 35.0 37.0 7 36.29425 37.0 37.0 37.0 35.0 37.0 8 36.22775 37.0 37.0 37.0 35.0 37.0 9 38.092 39.0 39.0 39.0 37.0 39.0 10 38.01475 39.0 38.0 39.0 35.0 39.0 11 37.837 39.0 38.0 39.0 35.0 39.0 12 38.02825 39.0 39.0 39.0 35.0 39.0 13 37.98475 39.0 38.0 39.0 35.0 39.0 14 39.581 41.0 39.0 41.0 37.0 41.0 15 39.5245 41.0 39.0 41.0 37.0 41.0 16 39.3295 41.0 39.0 41.0 36.0 41.0 17 39.4595 41.0 39.0 41.0 36.0 41.0 18 39.4845 41.0 39.0 41.0 37.0 41.0 19 39.493 41.0 39.0 41.0 37.0 41.0 20 39.50225 41.0 39.0 41.0 37.0 41.0 21 39.3905 41.0 39.0 41.0 36.0 41.0 22 39.372 41.0 39.0 41.0 36.0 41.0 23 39.29975 41.0 39.0 41.0 36.0 41.0 24 39.27025 41.0 39.0 41.0 36.0 41.0 25 39.32025 41.0 39.0 41.0 36.0 41.0 26 39.234 41.0 39.0 41.0 36.0 41.0 27 39.167 41.0 39.0 41.0 36.0 41.0 28 39.142 41.0 39.0 41.0 36.0 41.0 29 39.08175 40.0 39.0 41.0 36.0 41.0 30 39.07625 40.0 39.0 41.0 36.0 41.0 31 39.0675 40.0 39.0 41.0 36.0 41.0 32 38.9195 40.0 39.0 41.0 35.0 41.0 33 38.965 40.0 39.0 41.0 35.0 41.0 34 38.949 40.0 39.0 41.0 35.0 41.0 35 38.91375 40.0 38.0 41.0 35.0 41.0 36 38.8785 40.0 39.0 41.0 35.0 41.0 37 38.72725 40.0 39.0 41.0 35.0 41.0 38 38.64575 40.0 38.0 41.0 34.0 41.0 39 38.60525 40.0 38.0 41.0 34.0 41.0 40 38.51725 40.0 38.0 41.0 35.0 41.0 41 38.357 40.0 38.0 41.0 33.0 41.0 42 38.31775 40.0 38.0 41.0 34.0 41.0 43 38.30325 40.0 38.0 41.0 34.0 41.0 44 38.33325 40.0 38.0 41.0 34.0 41.0 45 38.236 40.0 38.0 41.0 34.0 41.0 46 38.08075 40.0 38.0 41.0 33.0 41.0 47 38.04875 40.0 38.0 41.0 33.0 41.0 48 37.90375 40.0 38.0 41.0 33.0 41.0 49 37.74025 40.0 37.0 41.0 33.0 41.0 50 37.73875 40.0 37.0 41.0 33.0 41.0 51 37.7165 40.0 37.0 41.0 32.0 41.0 52 35.89675 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 3.0 23 5.0 24 9.0 25 6.0 26 13.0 27 8.0 28 16.0 29 12.0 30 45.0 31 56.0 32 70.0 33 78.0 34 108.0 35 169.0 36 198.0 37 351.0 38 815.0 39 2026.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.06331877729257 11.926855895196505 10.09825327510917 40.911572052401745 2 22.6 16.55 35.099999999999994 25.75 3 20.424999999999997 20.275000000000002 24.375 34.925 4 24.05 28.349999999999998 21.775 25.825 5 23.325000000000003 32.225 23.375 21.075 6 19.400000000000002 32.45 24.349999999999998 23.799999999999997 7 16.25 20.65 42.0 21.099999999999998 8 18.825 20.7 29.349999999999998 31.125000000000004 9 19.2 19.725 32.725 28.349999999999998 10 20.150000000000002 35.0 23.75 21.099999999999998 11 24.325 25.224999999999998 21.425 29.025000000000002 12 23.474999999999998 21.224999999999998 25.5 29.799999999999997 13 20.175 26.125 27.875 25.825 14 21.475 24.775 27.900000000000002 25.85 15 21.475 24.525 26.3 27.700000000000003 16 22.025 25.95 25.525 26.5 17 23.075000000000003 24.474999999999998 25.6 26.85 18 21.55 26.05 26.75 25.650000000000002 19 22.725 25.874999999999996 25.724999999999998 25.674999999999997 20 22.825 25.05 26.25 25.874999999999996 21 22.625 25.8 25.900000000000002 25.674999999999997 22 22.45 25.575 25.8 26.174999999999997 23 20.75 25.825 26.375 27.05 24 21.325 24.575 26.35 27.750000000000004 25 22.45 24.875 25.575 27.1 26 21.85 25.324999999999996 26.900000000000002 25.924999999999997 27 22.400000000000002 23.974999999999998 25.7 27.925 28 21.975 26.775 24.875 26.375 29 22.475 26.05 26.5 24.975 30 21.775 23.849999999999998 26.724999999999998 27.650000000000002 31 21.224999999999998 26.55 25.974999999999998 26.25 32 22.6 24.825 26.325 26.25 33 21.525 23.724999999999998 27.425 27.325 34 21.125 26.25 26.974999999999998 25.650000000000002 35 23.275000000000002 24.2 25.95 26.575 36 22.75 26.025 24.25 26.974999999999998 37 22.75 25.15 25.25 26.85 38 23.799999999999997 23.95 26.150000000000002 26.1 39 23.125 24.325 25.6 26.950000000000003 40 22.15 25.2 25.2 27.450000000000003 41 22.925 25.55 25.650000000000002 25.874999999999996 42 22.1 23.974999999999998 27.05 26.875 43 23.3 24.099999999999998 25.75 26.85 44 22.15 24.099999999999998 26.85 26.900000000000002 45 22.075 24.65 26.275 27.0 46 24.7 23.775 25.5 26.025 47 23.599999999999998 23.275000000000002 27.125 26.0 48 22.85 22.675 26.25 28.225 49 22.725 23.9 26.8 26.575 50 23.0 23.75 26.724999999999998 26.525 51 23.625 24.55 25.374999999999996 26.450000000000003 52 22.375 25.374999999999996 25.724999999999998 26.525 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 2.0 18 1.0 19 0.0 20 2.0 21 4.0 22 3.5 23 3.0 24 5.5 25 8.0 26 10.0 27 12.0 28 16.0 29 20.0 30 25.0 31 30.0 32 45.0 33 60.0 34 73.0 35 86.0 36 105.5 37 125.0 38 127.0 39 158.5 40 188.0 41 218.0 42 248.0 43 270.5 44 293.0 45 320.5 46 348.0 47 339.0 48 330.0 49 354.5 50 379.0 51 379.5 52 380.0 53 383.5 54 387.0 55 354.0 56 321.0 57 272.0 58 223.0 59 192.5 60 162.0 61 135.0 62 108.0 63 80.0 64 48.0 65 44.0 66 36.0 67 28.0 68 20.0 69 12.0 70 10.0 71 8.0 72 4.5 73 1.0 74 3.5 75 6.0 76 3.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10110341288171 95.575 2 1.4626635873749037 2.85 3 0.2822684115986656 0.8250000000000001 4 0.051321529381575574 0.2 5 0.051321529381575574 0.25 6 0.051321529381575574 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGG 6 0.15 No Hit GGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAA 6 0.15 No Hit GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGC 5 0.125 No Hit GTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra Read 200000 spots for SRR5423544.sra Written 200000 spots for SRR5423544.sra SRR ids: ['SRR5423544.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wn7_bs6c SRR5423544.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423544 file size 703987 SRR5423544 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423544 SRR5423544_1.fastq Input file: SRR5423544_1.fastq trimmed: SRR5423544-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:06:37 2025 >> started Thu Feb 13 13:06:39 2025 >> done (1.977s) 4000000 reads processed; of these: 161 ( 0.00%) short reads filtered out after trimming by size control 384 ( 0.01%) empty reads filtered out after trimming by size control 3999455 (99.99%) reads available; of these: 56029 ( 1.40%) trimmed reads available after processing 3943426 (98.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 5 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 1 0.00% 26 2 0.00% 27 6 0.00% 28 2 0.00% 29 3 0.00% 30 4 0.00% 31 2 0.00% 32 6 0.00% 33 12 0.00% 34 18 0.00% 35 14 0.00% 36 20 0.00% 37 21 0.00% 38 23 0.00% 39 35 0.00% 40 46 0.00% 41 56 0.00% 42 59 0.00% 43 97 0.00% 44 136 0.00% 45 205 0.01% 46 311 0.01% 47 486 0.01% 48 894 0.02% 49 1864 0.05% 50 5871 0.15% 51 45815 1.15% 52 3943426 98.60% 3999455 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=35 prefix-density=0.19 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=12.48 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:06:55 Started mapping on | Feb 13 13:06:55 Finished on | Feb 13 13:07:01 Mapping speed, Million of reads per hour | 2399.67 Number of input reads | 3999455 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3694669 Uniquely mapped reads % | 92.38% Average mapped length | 51.84 Number of splices: Total | 492260 Number of splices: Annotated (sjdb) | 486093 Number of splices: GT/AG | 482631 Number of splices: GC/AG | 8878 Number of splices: AT/AC | 277 Number of splices: Non-canonical | 474 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250745 % of reads mapped to multiple loci | 6.27% Number of reads mapped to too many loci | 40567 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54041 54041 54041 N_multimapping 250745 250745 250745 N_noFeature 124259 3651233 144032 N_ambiguous 43103 28 19427 UnstrandedReadsAssigned:3527307 PositiveStrandReadsAssigned:43408 NegativeStrandReadsAssigned:3531210 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423544 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423544-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,455 reads, 3,668,227 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR5423544.ke.tsv 34699 SRR5423544.se.tsv 87100 total ==> SRR5423544.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 94 13.054 Potri.005G024800.1.v4.1 1035 936 17 4.8402 Potri.004G059700.1.v4.1 961 862 5 1.5458 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 45.2615 4.24121 Potri.016G087400.1.v4.1 270 171 116 180.781 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.159197 Potri.012G127500.1.v4.1 977 878 57 17.301 ==> SRR5423544.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 77 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5423544 completed mapping pipeline successfully