Starting /dee2/code/volunteer_pipeline.sh SRR5423545 current disk space = 3090994659328 free memory = 1449708600 SRR5423545 SRAfilesize cd9becb37f7275e7ca82796ec9364e49 SRR5423545.sra SRR5423545.sra file validated SRR5423545 is single end SRR5423545 is conventional basespace SRR5423545 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423545_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.5395 31.0 31.0 34.0 28.0 34.0 2 31.76875 31.0 31.0 34.0 30.0 34.0 3 31.954 33.0 31.0 34.0 30.0 34.0 4 33.3765 35.0 33.0 37.0 25.0 37.0 5 34.93025 37.0 35.0 37.0 32.0 37.0 6 35.3225 37.0 35.0 37.0 32.0 37.0 7 35.6555 37.0 35.0 37.0 33.0 37.0 8 35.63975 37.0 35.0 37.0 33.0 37.0 9 37.489 39.0 37.0 39.0 35.0 39.0 10 37.4425 39.0 37.0 39.0 34.0 39.0 11 37.428 39.0 37.0 39.0 34.0 39.0 12 37.43225 39.0 37.0 39.0 34.0 39.0 13 37.44125 39.0 37.0 39.0 35.0 39.0 14 38.7585 40.0 38.0 41.0 35.0 41.0 15 38.64275 40.0 38.0 41.0 34.0 41.0 16 38.41275 40.0 38.0 41.0 33.0 41.0 17 38.3715 40.0 38.0 41.0 33.0 41.0 18 38.43175 40.0 38.0 41.0 34.0 41.0 19 38.5445 40.0 38.0 41.0 34.0 41.0 20 38.48075 40.0 38.0 41.0 34.0 41.0 21 38.45525 40.0 38.0 41.0 34.0 41.0 22 38.51675 40.0 38.0 41.0 34.0 41.0 23 38.48925 40.0 38.0 41.0 34.0 41.0 24 38.52725 40.0 38.0 41.0 34.0 41.0 25 38.54275 40.0 38.0 41.0 34.0 41.0 26 38.554 40.0 38.0 41.0 34.0 41.0 27 38.46875 40.0 38.0 41.0 34.0 41.0 28 38.52875 40.0 38.0 41.0 34.0 41.0 29 38.3815 40.0 38.0 41.0 34.0 41.0 30 38.23825 40.0 38.0 41.0 33.0 41.0 31 38.1085 40.0 38.0 41.0 33.0 41.0 32 38.083 40.0 38.0 41.0 33.0 41.0 33 38.1115 40.0 38.0 41.0 33.0 41.0 34 38.098 40.0 38.0 41.0 33.0 41.0 35 37.93075 40.0 37.0 41.0 33.0 41.0 36 38.12175 40.0 38.0 41.0 33.0 41.0 37 37.94525 40.0 37.0 41.0 33.0 41.0 38 38.017 40.0 37.0 41.0 33.0 41.0 39 38.00025 40.0 37.0 41.0 33.0 41.0 40 37.86625 40.0 37.0 41.0 33.0 41.0 41 37.6875 40.0 37.0 41.0 32.0 41.0 42 37.62625 40.0 37.0 41.0 32.0 41.0 43 37.31625 40.0 36.0 41.0 31.0 41.0 44 37.28125 40.0 36.0 41.0 31.0 41.0 45 37.48775 40.0 36.0 41.0 32.0 41.0 46 37.4595 40.0 37.0 41.0 31.0 41.0 47 37.49375 40.0 37.0 41.0 31.0 41.0 48 37.34525 40.0 36.0 41.0 31.0 41.0 49 37.26075 39.0 36.0 41.0 31.0 41.0 50 37.361 39.0 36.0 41.0 31.0 41.0 51 36.915 39.0 35.0 41.0 30.0 41.0 52 36.25625 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1113 1 0.0 1113 2 0.0 1113 3 0.0 1113 4 0.0 1113 5 0.0 1113 6 0.0 1113 7 0.0 1113 8 0.0 1113 9 0.0 1113 10 0.0 1113 11 0.0 1113 12 0.0 1113 13 0.0 1113 14 0.0 1113 15 0.0 1113 16 0.0 1113 17 0.0 1113 18 0.0 1113 19 0.0 1113 20 0.0 1113 21 0.0 1113 22 0.0 1113 23 0.0 1113 24 0.0 1113 25 0.0 1113 26 0.0 1113 27 0.0 1113 28 0.0 1113 29 0.0 1113 30 0.0 1113 31 0.0 1113 32 0.0 1113 33 0.0 1113 34 0.0 1113 35 0.0 1113 36 0.0 1113 37 0.0 1113 38 0.0 1113 39 0.0 1113 40 0.0 1113 41 0.0 1113 42 0.0 1113 43 0.0 1113 44 0.0 1113 45 0.0 1113 46 0.0 1113 47 0.0 1113 48 0.0 1113 49 0.0 1113 50 0.0 1113 51 0.0 1113 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.0 24 6.0 25 9.0 26 13.0 27 22.0 28 44.0 29 43.0 30 67.0 31 71.0 32 119.0 33 142.0 34 168.0 35 229.0 36 337.0 37 430.0 38 746.0 39 1543.0 40 5.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.987987987987985 11.811811811811811 9.284284284284285 40.91591591591592 2 21.224999999999998 16.975 36.125 25.674999999999997 3 20.875 20.175 23.95 35.0 4 23.125 27.55 24.224999999999998 25.1 5 23.95 32.125 23.65 20.275000000000002 6 20.5 32.025 23.775 23.7 7 16.05 22.15 41.25 20.549999999999997 8 18.4 21.375 30.2 30.025000000000002 9 19.55 20.424999999999997 31.8 28.225 10 19.275000000000002 36.275 22.650000000000002 21.8 11 24.95 24.025 21.9 29.125 12 23.025000000000002 21.725 26.724999999999998 28.525 13 20.349999999999998 24.075 26.85 28.725 14 20.325 25.900000000000002 28.325 25.45 15 22.275 25.35 25.924999999999997 26.450000000000003 16 22.625 24.625 25.75 27.0 17 22.1 25.275 25.35 27.275 18 20.775 25.45 25.674999999999997 28.1 19 23.849999999999998 24.825 25.275 26.05 20 22.425 25.025 25.674999999999997 26.875 21 21.325 24.875 26.900000000000002 26.900000000000002 22 24.099999999999998 25.424999999999997 24.099999999999998 26.375 23 21.825 25.8 25.525 26.85 24 22.025 25.174999999999997 26.525 26.275 25 22.55 25.525 25.224999999999998 26.700000000000003 26 21.825 25.25 26.400000000000002 26.525 27 21.224999999999998 23.9 26.375 28.499999999999996 28 22.15 26.400000000000002 25.0 26.450000000000003 29 22.15 25.775 26.474999999999998 25.6 30 22.05 24.15 26.174999999999997 27.625 31 21.85 24.575 25.900000000000002 27.675 32 22.1 24.3 26.974999999999998 26.625 33 23.3 23.5 25.35 27.85 34 21.675 24.875 25.7 27.750000000000004 35 22.05 24.8 26.125 27.025 36 22.575 23.549999999999997 25.525 28.349999999999998 37 23.599999999999998 24.25 25.25 26.900000000000002 38 23.325000000000003 23.65 26.1 26.924999999999997 39 22.3 23.275000000000002 26.974999999999998 27.450000000000003 40 23.150000000000002 24.65 25.825 26.375 41 23.3 24.95 26.0 25.75 42 23.275000000000002 24.575 25.3 26.85 43 24.099999999999998 23.849999999999998 25.074999999999996 26.974999999999998 44 22.575 24.8 25.95 26.674999999999997 45 23.125 24.3 25.474999999999998 27.1 46 23.825 24.425 24.675 27.075 47 22.725 24.375 26.575 26.325 48 21.775 23.1 26.900000000000002 28.225 49 23.849999999999998 24.9 24.2 27.05 50 22.775000000000002 23.674999999999997 26.174999999999997 27.375 51 22.475 23.375 26.125 28.025 52 22.900000000000002 23.95 26.174999999999997 26.974999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 3.5 23 3.0 24 2.5 25 2.0 26 7.5 27 13.0 28 19.0 29 25.0 30 27.5 31 30.0 32 38.0 33 46.0 34 54.0 35 62.0 36 76.0 37 90.0 38 109.0 39 138.0 40 148.0 41 181.0 42 214.0 43 268.5 44 323.0 45 344.5 46 366.0 47 363.5 48 361.0 49 386.0 50 411.0 51 413.0 52 415.0 53 404.0 54 393.0 55 338.0 56 283.0 57 251.5 58 220.0 59 193.5 60 167.0 61 144.0 62 121.0 63 92.5 64 57.5 65 51.0 66 36.0 67 21.0 68 18.5 69 16.0 70 12.5 71 9.0 72 6.5 73 4.0 74 4.0 75 4.0 76 3.5 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.75946433170229 94.89999999999999 2 1.7512232809683237 3.4000000000000004 3 0.38629925315477726 1.125 4 0.02575328354365182 0.1 5 0.02575328354365182 0.125 6 0.02575328354365182 0.15 7 0.0 0.0 8 0.02575328354365182 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 8 0.2 No Hit GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTG 6 0.15 No Hit GTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra Read 200000 spots for SRR5423545.sra Written 200000 spots for SRR5423545.sra SRR ids: ['SRR5423545.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ptranolq SRR5423545.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423545 file size 704012 SRR5423545 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423545 SRR5423545_1.fastq Input file: SRR5423545_1.fastq trimmed: SRR5423545-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:21:30 2025 >> started Thu Feb 13 13:21:33 2025 >> done (2.708s) 4000000 reads processed; of these: 189 ( 0.00%) short reads filtered out after trimming by size control 408 ( 0.01%) empty reads filtered out after trimming by size control 3999403 (99.99%) reads available; of these: 66699 ( 1.67%) trimmed reads available after processing 3932704 (98.33%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 0 0.00% 26 2 0.00% 27 3 0.00% 28 8 0.00% 29 6 0.00% 30 1 0.00% 31 10 0.00% 32 6 0.00% 33 15 0.00% 34 10 0.00% 35 9 0.00% 36 18 0.00% 37 22 0.00% 38 29 0.00% 39 52 0.00% 40 52 0.00% 41 61 0.00% 42 70 0.00% 43 115 0.00% 44 166 0.00% 45 265 0.01% 46 402 0.01% 47 637 0.02% 48 1097 0.03% 49 2374 0.06% 50 7242 0.18% 51 54009 1.35% 52 3932704 98.33% 3999403 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=1.9 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=13.52 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=1.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:21:44 Started mapping on | Feb 13 13:21:44 Finished on | Feb 13 13:21:49 Mapping speed, Million of reads per hour | 2879.57 Number of input reads | 3999403 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3695233 Uniquely mapped reads % | 92.39% Average mapped length | 51.83 Number of splices: Total | 491515 Number of splices: Annotated (sjdb) | 485321 Number of splices: GT/AG | 481907 Number of splices: GC/AG | 8863 Number of splices: AT/AC | 278 Number of splices: Non-canonical | 467 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249363 % of reads mapped to multiple loci | 6.24% Number of reads mapped to too many loci | 40748 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54807 54807 54807 N_multimapping 249363 249363 249363 N_noFeature 124439 3652077 143841 N_ambiguous 43334 50 19548 UnstrandedReadsAssigned:3527460 PositiveStrandReadsAssigned:43106 NegativeStrandReadsAssigned:3531844 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423545 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423545-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,403 reads, 3,665,651 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,169 rounds 52401 SRR5423545.ke.tsv 34699 SRR5423545.se.tsv 87100 total ==> SRR5423545.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 102 14.1996 Potri.005G024800.1.v4.1 1035 936 15 4.28121 Potri.004G059700.1.v4.1 961 862 14 4.33882 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 24 2.25441 Potri.016G087400.1.v4.1 270 171 98 153.102 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 61 18.5604 ==> SRR5423545.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 73 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423545 completed mapping pipeline successfully