Starting /dee2/code/volunteer_pipeline.sh SRR5423546 current disk space = 3090719023104 free memory = 1485658564 SRR5423546 SRAfilesize b544c5313850b6c26d76da7f8cceaeac SRR5423546.sra SRR5423546.sra file validated SRR5423546 is single end SRR5423546 is conventional basespace SRR5423546 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423546_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.38525 34.0 31.0 34.0 30.0 34.0 2 32.50525 34.0 31.0 34.0 30.0 34.0 3 32.364 34.0 31.0 34.0 30.0 34.0 4 36.00725 37.0 35.0 37.0 35.0 37.0 5 35.92375 37.0 35.0 37.0 35.0 37.0 6 35.97225 37.0 35.0 37.0 35.0 37.0 7 35.941 37.0 35.0 37.0 35.0 37.0 8 35.85275 37.0 35.0 37.0 35.0 37.0 9 37.376 39.0 37.0 39.0 34.0 39.0 10 37.511 39.0 37.0 39.0 35.0 39.0 11 37.6275 39.0 37.0 39.0 35.0 39.0 12 37.68175 39.0 37.0 39.0 35.0 39.0 13 37.58025 39.0 37.0 39.0 35.0 39.0 14 39.005 40.0 38.0 41.0 36.0 41.0 15 39.024 40.0 38.0 41.0 36.0 41.0 16 38.83125 40.0 38.0 41.0 35.0 41.0 17 38.8455 40.0 38.0 41.0 35.0 41.0 18 38.91425 40.0 38.0 41.0 36.0 41.0 19 39.01175 40.0 39.0 41.0 35.0 41.0 20 38.946 40.0 38.0 41.0 35.0 41.0 21 39.05525 40.0 39.0 41.0 35.0 41.0 22 38.94325 40.0 38.0 41.0 35.0 41.0 23 38.86825 40.0 38.0 41.0 35.0 41.0 24 38.932 40.0 38.0 41.0 35.0 41.0 25 38.83825 40.0 38.0 41.0 34.0 41.0 26 38.42675 40.0 38.0 41.0 34.0 41.0 27 38.69825 40.0 38.0 41.0 34.0 41.0 28 38.86875 40.0 38.0 41.0 35.0 41.0 29 38.83 40.0 38.0 41.0 35.0 41.0 30 38.7305 40.0 38.0 41.0 35.0 41.0 31 38.821 40.0 38.0 41.0 35.0 41.0 32 38.74725 40.0 38.0 41.0 35.0 41.0 33 38.7125 40.0 38.0 41.0 35.0 41.0 34 38.78075 40.0 38.0 41.0 35.0 41.0 35 38.63975 40.0 38.0 41.0 34.0 41.0 36 38.67175 40.0 38.0 41.0 35.0 41.0 37 38.61675 40.0 38.0 41.0 35.0 41.0 38 38.43425 40.0 38.0 41.0 34.0 41.0 39 38.074 40.0 38.0 41.0 33.0 41.0 40 37.99275 40.0 38.0 41.0 33.0 41.0 41 38.0715 40.0 38.0 41.0 33.0 41.0 42 37.93775 40.0 38.0 41.0 33.0 41.0 43 37.86875 40.0 37.0 41.0 32.0 41.0 44 37.93025 40.0 37.0 41.0 33.0 41.0 45 37.77475 40.0 37.0 41.0 32.0 41.0 46 37.834 40.0 37.0 41.0 33.0 41.0 47 37.9145 40.0 37.0 41.0 33.0 41.0 48 37.79175 40.0 37.0 41.0 33.0 41.0 49 37.661 40.0 37.0 41.0 32.0 41.0 50 37.3415 40.0 36.0 41.0 31.0 41.0 51 37.2935 40.0 36.0 41.0 31.0 41.0 52 36.072 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1208 1 0.0 1208 2 0.0 1208 3 0.0 1208 4 0.0 1208 5 0.0 1208 6 0.0 1208 7 0.0 1208 8 0.0 1208 9 0.0 1208 10 0.0 1208 11 0.0 1208 12 0.0 1208 13 0.0 1208 14 0.0 1208 15 0.0 1208 16 0.0 1208 17 0.0 1208 18 0.0 1208 19 0.0 1208 20 0.0 1208 21 0.0 1208 22 0.0 1208 23 0.0 1208 24 0.0 1208 25 0.0 1208 26 0.0 1208 27 0.0 1208 28 0.0 1208 29 0.0 1208 30 0.0 1208 31 0.0 1208 32 0.0 1208 33 0.0 1208 34 0.0 1208 35 0.0 1208 36 0.0 1208 37 0.0 1208 38 0.0 1208 39 0.0 1208 40 0.0 1208 41 0.0 1208 42 0.0 1208 43 0.0 1208 44 0.0 1208 45 0.0 1208 46 0.0 1208 47 0.0 1208 48 0.0 1208 49 0.0 1208 50 0.0 1208 51 0.0 1208 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 1.0 23 4.0 24 8.0 25 12.0 26 12.0 27 17.0 28 22.0 29 34.0 30 41.0 31 68.0 32 83.0 33 101.0 34 149.0 35 193.0 36 244.0 37 401.0 38 695.0 39 1906.0 40 7.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.201402805611224 11.748496993987976 9.3937875751503 40.6563126252505 2 20.375 17.375 35.75 26.5 3 20.525 19.975 24.625 34.875 4 24.575 28.175 21.65 25.6 5 23.474999999999998 32.7 23.35 20.474999999999998 6 20.599999999999998 31.974999999999998 23.575 23.849999999999998 7 17.575 21.8 40.275 20.349999999999998 8 18.55 20.150000000000002 30.475 30.825000000000003 9 18.25 20.7 31.45 29.599999999999998 10 19.05 35.725 23.9 21.325 11 25.1 25.0 20.65 29.25 12 24.0 21.8 24.925 29.275000000000002 13 21.925 24.55 26.525 27.0 14 21.025 25.900000000000002 27.575 25.5 15 19.975 25.6 26.6 27.825 16 22.400000000000002 24.85 26.525 26.224999999999998 17 21.425 25.224999999999998 26.075 27.275 18 22.875 25.35 25.575 26.200000000000003 19 21.95 26.625 25.424999999999997 26.0 20 23.375 25.474999999999998 26.25 24.9 21 22.2 25.5 25.05 27.250000000000004 22 21.875 26.974999999999998 25.75 25.4 23 22.475 26.275 27.05 24.2 24 23.075000000000003 23.799999999999997 26.1 27.025 25 22.975 24.85 25.174999999999997 27.0 26 22.95 25.5 25.924999999999997 25.624999999999996 27 21.425 25.3 26.35 26.924999999999997 28 22.675 26.275 26.400000000000002 24.65 29 22.900000000000002 25.874999999999996 25.05 26.174999999999997 30 20.225 26.0 26.5 27.275 31 23.425 24.5 24.85 27.224999999999998 32 23.175 23.65 28.449999999999996 24.725 33 22.975 23.75 26.525 26.75 34 21.2 25.05 26.825 26.924999999999997 35 22.075 24.6 26.974999999999998 26.35 36 22.5 24.825 25.55 27.125 37 24.15 24.175 25.724999999999998 25.95 38 21.65 24.025 26.75 27.575 39 22.575 23.425 26.35 27.650000000000002 40 22.575 25.05 25.974999999999998 26.400000000000002 41 22.775000000000002 23.875 26.625 26.724999999999998 42 22.325 24.099999999999998 26.974999999999998 26.6 43 23.549999999999997 24.55 25.0 26.900000000000002 44 22.625 24.4 27.05 25.924999999999997 45 22.675 24.25 26.8 26.275 46 23.55588897224306 23.78094523630908 25.93148287071768 26.731682920730183 47 23.25 24.425 26.1 26.224999999999998 48 22.1055263815954 23.10577644411103 26.481620405101275 28.307076769192296 49 23.7 24.349999999999998 26.8 25.15 50 23.055763940985248 24.33108277069267 25.6064016004001 27.00675168792198 51 22.900000000000002 22.900000000000002 26.700000000000003 27.500000000000004 52 23.400000000000002 24.2 26.450000000000003 25.95 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 4.0 24 5.0 25 6.0 26 9.0 27 12.0 28 16.0 29 20.0 30 26.5 31 33.0 32 46.5 33 60.0 34 65.0 35 70.0 36 86.5 37 103.0 38 126.0 39 149.5 40 150.0 41 199.0 42 248.0 43 268.5 44 289.0 45 308.0 46 327.0 47 355.5 48 384.0 49 392.0 50 400.0 51 400.5 52 401.0 53 391.5 54 382.0 55 349.0 56 316.0 57 278.0 58 240.0 59 203.5 60 167.0 61 127.5 62 88.0 63 71.0 64 46.0 65 38.0 66 29.0 67 20.0 68 15.5 69 11.0 70 9.5 71 8.0 72 8.0 73 8.0 74 7.5 75 7.0 76 4.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.975 #Duplication Level Percentage of deduplicated Percentage of total 1 97.6798143851508 94.72500000000001 2 1.7788089713843775 3.45 3 0.3866976024748647 1.125 4 0.10311936065996391 0.4 5 0.025779840164990978 0.125 6 0.0 0.0 7 0.025779840164990978 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 7 0.17500000000000002 No Hit GTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra Read 200000 spots for SRR5423546.sra Written 200000 spots for SRR5423546.sra SRR ids: ['SRR5423546.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__i61awaa SRR5423546.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423546 file size 703967 SRR5423546 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423546 SRR5423546_1.fastq Input file: SRR5423546_1.fastq trimmed: SRR5423546-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:33:45 2025 >> started Thu Feb 13 13:33:47 2025 >> done (1.880s) 4000000 reads processed; of these: 172 ( 0.00%) short reads filtered out after trimming by size control 429 ( 0.01%) empty reads filtered out after trimming by size control 3999399 (99.98%) reads available; of these: 60349 ( 1.51%) trimmed reads available after processing 3939050 (98.49%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 5 0.00% 20 3 0.00% 21 0 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 3 0.00% 28 8 0.00% 29 4 0.00% 30 4 0.00% 31 6 0.00% 32 8 0.00% 33 6 0.00% 34 13 0.00% 35 8 0.00% 36 17 0.00% 37 19 0.00% 38 20 0.00% 39 32 0.00% 40 34 0.00% 41 58 0.00% 42 70 0.00% 43 97 0.00% 44 134 0.00% 45 190 0.00% 46 302 0.01% 47 479 0.01% 48 856 0.02% 49 1986 0.05% 50 6376 0.16% 51 49604 1.24% 52 3939050 98.49% 3999399 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=12.82 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:34:03 Started mapping on | Feb 13 13:34:03 Finished on | Feb 13 13:34:09 Mapping speed, Million of reads per hour | 2399.64 Number of input reads | 3999399 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3695889 Uniquely mapped reads % | 92.41% Average mapped length | 51.84 Number of splices: Total | 490678 Number of splices: Annotated (sjdb) | 484394 Number of splices: GT/AG | 480877 Number of splices: GC/AG | 9024 Number of splices: AT/AC | 269 Number of splices: Non-canonical | 508 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.56 Insertion rate per base | 0.00% Insertion average length | 1.37 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249294 % of reads mapped to multiple loci | 6.23% Number of reads mapped to too many loci | 40926 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54216 54216 54216 N_multimapping 249294 249294 249294 N_noFeature 124371 3652459 143996 N_ambiguous 43520 45 19684 UnstrandedReadsAssigned:3527998 PositiveStrandReadsAssigned:43385 NegativeStrandReadsAssigned:3532209 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423546 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423546-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,399 reads, 3,665,492 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52401 SRR5423546.ke.tsv 34699 SRR5423546.se.tsv 87100 total ==> SRR5423546.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 99 13.7554 Potri.005G024800.1.v4.1 1035 936 12 3.41837 Potri.004G059700.1.v4.1 961 862 14 4.33047 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 41.9945 3.9371 Potri.016G087400.1.v4.1 270 171 92 143.452 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 63 19.132 ==> SRR5423546.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 59 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423546 completed mapping pipeline successfully