Starting /dee2/code/volunteer_pipeline.sh SRR5423547 current disk space = 3090672930816 free memory = 1445484048 SRR5423547 SRAfilesize a51deab4517a6c6abfa8cc95ed29da39 SRR5423547.sra SRR5423547.sra file validated SRR5423547 is single end SRR5423547 is conventional basespace SRR5423547 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423547_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.57025 34.0 31.0 34.0 31.0 34.0 2 32.6865 34.0 31.0 34.0 31.0 34.0 3 32.7805 34.0 31.0 34.0 31.0 34.0 4 36.14975 37.0 37.0 37.0 35.0 37.0 5 36.1405 37.0 37.0 37.0 35.0 37.0 6 36.08625 37.0 37.0 37.0 35.0 37.0 7 36.0795 37.0 36.0 37.0 35.0 37.0 8 36.11525 37.0 36.0 37.0 35.0 37.0 9 37.81875 39.0 38.0 39.0 35.0 39.0 10 37.773 39.0 38.0 39.0 35.0 39.0 11 37.8835 39.0 38.0 39.0 35.0 39.0 12 37.86025 39.0 38.0 39.0 35.0 39.0 13 37.81325 39.0 38.0 39.0 35.0 39.0 14 39.12975 41.0 39.0 41.0 36.0 41.0 15 39.14175 41.0 39.0 41.0 36.0 41.0 16 39.21225 41.0 39.0 41.0 36.0 41.0 17 39.23425 40.0 39.0 41.0 36.0 41.0 18 39.08375 40.0 38.0 41.0 36.0 41.0 19 39.081 40.0 39.0 41.0 36.0 41.0 20 39.0885 40.0 39.0 41.0 36.0 41.0 21 39.15325 40.0 39.0 41.0 36.0 41.0 22 39.16075 40.0 39.0 41.0 36.0 41.0 23 39.12625 40.0 39.0 41.0 36.0 41.0 24 38.92 40.0 39.0 41.0 35.0 41.0 25 38.991 40.0 39.0 41.0 35.0 41.0 26 38.91175 40.0 39.0 41.0 35.0 41.0 27 38.80075 40.0 38.0 41.0 35.0 41.0 28 38.9145 40.0 39.0 41.0 35.0 41.0 29 38.72025 40.0 38.0 41.0 35.0 41.0 30 38.77825 40.0 38.0 41.0 35.0 41.0 31 38.4865 40.0 38.0 41.0 34.0 41.0 32 38.56625 40.0 38.0 41.0 34.0 41.0 33 38.583 40.0 38.0 41.0 34.0 41.0 34 38.67825 40.0 38.0 41.0 35.0 41.0 35 38.73825 40.0 38.0 41.0 35.0 41.0 36 38.69675 40.0 38.0 41.0 35.0 41.0 37 38.54475 40.0 38.0 41.0 34.0 41.0 38 38.49175 40.0 38.0 41.0 34.0 41.0 39 38.442 40.0 38.0 41.0 34.0 41.0 40 38.45425 40.0 38.0 41.0 34.0 41.0 41 38.2505 40.0 38.0 41.0 33.0 41.0 42 38.13425 40.0 38.0 41.0 33.0 41.0 43 38.124 40.0 38.0 41.0 33.0 41.0 44 38.09975 40.0 38.0 41.0 33.0 41.0 45 38.04575 40.0 38.0 41.0 33.0 41.0 46 38.03075 40.0 37.0 41.0 33.0 41.0 47 37.8945 40.0 37.0 41.0 33.0 41.0 48 37.77775 40.0 37.0 41.0 33.0 41.0 49 37.76 40.0 37.0 41.0 33.0 41.0 50 37.82525 40.0 37.0 41.0 33.0 41.0 51 37.72825 40.0 37.0 41.0 33.0 41.0 52 36.282 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1303 1 0.0 1303 2 0.0 1303 3 0.0 1303 4 0.0 1303 5 0.0 1303 6 0.0 1303 7 0.0 1303 8 0.0 1303 9 0.0 1303 10 0.0 1303 11 0.0 1303 12 0.0 1303 13 0.0 1303 14 0.0 1303 15 0.0 1303 16 0.0 1303 17 0.0 1303 18 0.0 1303 19 0.0 1303 20 0.0 1303 21 0.0 1303 22 0.0 1303 23 0.0 1303 24 0.0 1303 25 0.0 1303 26 0.0 1303 27 0.0 1303 28 0.0 1303 29 0.0 1303 30 0.0 1303 31 0.0 1303 32 0.0 1303 33 0.0 1303 34 0.0 1303 35 0.0 1303 36 0.0 1303 37 0.0 1303 38 0.0 1303 39 0.0 1303 40 0.0 1303 41 0.0 1303 42 0.0 1303 43 0.0 1303 44 0.0 1303 45 0.0 1303 46 0.0 1303 47 0.0 1303 48 0.0 1303 49 0.0 1303 50 0.0 1303 51 0.0 1303 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 2.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 3.0 22 2.0 23 6.0 24 5.0 25 12.0 26 9.0 27 23.0 28 14.0 29 23.0 30 40.0 31 62.0 32 69.0 33 90.0 34 128.0 35 166.0 36 240.0 37 360.0 38 705.0 39 2033.0 40 8.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.677354709418836 10.696392785571142 8.667334669338677 41.95891783567134 2 20.724999999999998 16.075 35.3 27.900000000000002 3 20.674999999999997 20.525 24.55 34.25 4 25.025 27.950000000000003 21.625 25.4 5 24.474999999999998 32.75 22.75 20.025000000000002 6 19.225 32.574999999999996 24.325 23.875 7 16.225 21.575 41.125 21.075 8 18.5 20.1 30.599999999999998 30.8 9 18.9 20.200000000000003 32.925 27.975 10 18.375 35.925000000000004 24.95 20.75 11 24.575 25.324999999999996 20.95 29.15 12 24.224999999999998 21.475 25.874999999999996 28.425 13 20.925 24.175 27.175 27.725 14 20.674999999999997 25.874999999999996 27.450000000000003 26.0 15 20.75 25.074999999999996 27.500000000000004 26.674999999999997 16 23.05 25.074999999999996 25.75 26.125 17 22.650000000000002 24.375 26.325 26.650000000000002 18 21.6 24.975 26.85 26.575 19 23.45 25.1 25.2 26.25 20 23.65 24.825 24.975 26.55 21 22.825 23.7 25.75 27.725 22 22.775000000000002 25.575 26.3 25.35 23 22.155538884721178 24.10602650662666 25.6064016004001 28.132033008252062 24 22.3 24.175 26.400000000000002 27.125 25 22.75 23.95 26.8 26.5 26 22.575 25.55 26.125 25.75 27 22.3 24.349999999999998 25.874999999999996 27.474999999999998 28 22.5 24.4 26.150000000000002 26.950000000000003 29 22.275 25.074999999999996 26.575 26.075 30 21.9 24.675 25.55 27.875 31 22.475 25.85 25.624999999999996 26.05 32 22.400000000000002 24.25 26.625 26.724999999999998 33 23.1 23.825 26.575 26.5 34 22.6 25.525 23.825 28.050000000000004 35 23.25 25.0 25.75 26.0 36 21.475 25.45 25.424999999999997 27.650000000000002 37 22.425 25.124999999999996 25.074999999999996 27.375 38 24.125 25.05 24.45 26.375 39 21.725 23.7 25.624999999999996 28.95 40 21.925 25.650000000000002 25.75 26.674999999999997 41 22.650000000000002 24.725 26.450000000000003 26.174999999999997 42 22.6 23.75 26.924999999999997 26.724999999999998 43 23.599999999999998 23.724999999999998 25.6 27.075 44 22.45 24.425 27.450000000000003 25.674999999999997 45 23.474999999999998 23.45 26.724999999999998 26.35 46 23.455863965991497 24.5311327831958 25.70642660665166 26.30657664416104 47 23.0 24.975 25.6 26.424999999999997 48 21.91095547773887 23.71185592796398 27.138569284642323 27.238619309654826 49 21.349999999999998 24.2 25.874999999999996 28.575 50 21.955488872218055 25.081270317579396 25.256314078519633 27.70692673168292 51 22.05551387846962 23.25581395348837 26.981745436359088 27.70692673168292 52 22.900000000000002 23.474999999999998 26.325 27.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 3.0 23 3.0 24 5.5 25 8.0 26 8.5 27 9.0 28 17.5 29 26.0 30 32.0 31 38.0 32 47.0 33 56.0 34 61.0 35 66.0 36 85.0 37 104.0 38 104.0 39 131.0 40 158.0 41 193.5 42 229.0 43 251.5 44 274.0 45 322.5 46 371.0 47 382.5 48 394.0 49 394.0 50 394.0 51 399.0 52 404.0 53 376.5 54 349.0 55 334.0 56 319.0 57 275.0 58 231.0 59 208.5 60 186.0 61 143.0 62 100.0 63 80.5 64 49.0 65 37.0 66 35.5 67 34.0 68 23.5 69 13.0 70 10.5 71 8.0 72 8.5 73 9.0 74 6.5 75 4.0 76 3.5 77 3.0 78 2.5 79 2.0 80 1.0 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.05 49 0.0 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.15 #Duplication Level Percentage of deduplicated Percentage of total 1 97.78692743180648 95.0 2 1.7498713329902211 3.4000000000000004 3 0.2573340195573855 0.75 4 0.18013381369016984 0.7000000000000001 5 0.0 0.0 6 0.02573340195573855 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.025 0.0 0.0 0.0 5 0.0 0.025 0.0 0.0 0.0 6 0.0 0.025 0.0 0.0 0.0 7 0.0 0.025 0.0 0.0 0.0 8 0.0 0.025 0.0 0.0 0.0 9 0.0 0.025 0.0 0.0 0.0 10 0.0 0.025 0.0 0.0 0.0 11 0.0 0.025 0.0 0.0 0.0 12 0.0 0.025 0.0 0.0 0.0 13 0.0 0.025 0.0 0.0 0.0 14 0.0 0.025 0.0 0.0 0.0 15 0.0 0.025 0.0 0.0 0.0 16 0.0 0.025 0.0 0.0 0.0 17 0.0 0.025 0.0 0.0 0.0 18 0.0 0.025 0.0 0.0 0.0 19 0.0 0.025 0.0 0.0 0.0 20 0.0 0.025 0.0 0.0 0.0 21 0.0 0.025 0.0 0.0 0.0 22 0.0 0.025 0.0 0.0 0.0 23 0.0 0.025 0.0 0.0 0.0 24 0.0 0.025 0.0 0.0 0.0 25 0.0 0.025 0.0 0.0 0.0 26 0.0 0.025 0.0 0.0 0.0 27 0.0 0.025 0.0 0.0 0.0 28 0.0 0.025 0.0 0.0 0.0 29 0.0 0.025 0.0 0.0 0.0 30 0.0 0.025 0.0 0.0 0.0 31 0.0 0.025 0.0 0.0 0.0 32 0.0 0.025 0.0 0.0 0.0 33 0.0 0.025 0.0 0.0 0.0 34 0.0 0.025 0.0 0.0 0.0 35 0.0 0.025 0.0 0.0 0.0 36 0.0 0.025 0.0 0.0 0.0 37 0.0 0.025 0.0 0.0 0.0 38 0.0 0.025 0.0 0.0 0.0 39 0.0 0.025 0.0 0.0 0.0 40 0.0 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra Read 200000 spots for SRR5423547.sra Written 200000 spots for SRR5423547.sra SRR ids: ['SRR5423547.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ia1z4o5d SRR5423547.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423547 file size 703968 SRR5423547 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423547 SRR5423547_1.fastq Input file: SRR5423547_1.fastq trimmed: SRR5423547-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:34:57 2025 >> started Thu Feb 13 13:34:59 2025 >> done (1.913s) 4000000 reads processed; of these: 147 ( 0.00%) short reads filtered out after trimming by size control 366 ( 0.01%) empty reads filtered out after trimming by size control 3999487 (99.99%) reads available; of these: 53781 ( 1.34%) trimmed reads available after processing 3945706 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 5 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 1 0.00% 26 3 0.00% 27 0 0.00% 28 4 0.00% 29 2 0.00% 30 7 0.00% 31 3 0.00% 32 9 0.00% 33 9 0.00% 34 3 0.00% 35 10 0.00% 36 16 0.00% 37 10 0.00% 38 25 0.00% 39 25 0.00% 40 33 0.00% 41 32 0.00% 42 57 0.00% 43 72 0.00% 44 103 0.00% 45 170 0.00% 46 277 0.01% 47 447 0.01% 48 721 0.02% 49 1683 0.04% 50 5502 0.14% 51 44536 1.11% 52 3945706 98.66% 3999487 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=12.87 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.4 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:35:08 Started mapping on | Feb 13 13:35:09 Finished on | Feb 13 13:35:13 Mapping speed, Million of reads per hour | 3599.54 Number of input reads | 3999487 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3694624 Uniquely mapped reads % | 92.38% Average mapped length | 51.84 Number of splices: Total | 492148 Number of splices: Annotated (sjdb) | 485906 Number of splices: GT/AG | 482559 Number of splices: GC/AG | 8865 Number of splices: AT/AC | 239 Number of splices: Non-canonical | 485 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250369 % of reads mapped to multiple loci | 6.26% Number of reads mapped to too many loci | 41398 % of reads mapped to too many loci | 1.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.32% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54494 54494 54494 N_multimapping 250369 250369 250369 N_noFeature 123946 3651592 143318 N_ambiguous 43052 44 19369 UnstrandedReadsAssigned:3527626 PositiveStrandReadsAssigned:42988 NegativeStrandReadsAssigned:3531937 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423547 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423547-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,487 reads, 3,668,245 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,127 rounds 52401 SRR5423547.ke.tsv 34699 SRR5423547.se.tsv 87100 total ==> SRR5423547.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 87 12.088 Potri.005G024800.1.v4.1 1035 936 16 4.55778 Potri.004G059700.1.v4.1 961 862 14 4.33042 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 36.4689 3.41902 Potri.016G087400.1.v4.1 270 171 101 157.483 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 57 17.3097 ==> SRR5423547.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 69 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR5423547 completed mapping pipeline successfully