Starting /dee2/code/volunteer_pipeline.sh SRR5423548 current disk space = 3090619281408 free memory = 1454169076 SRR5423548 SRAfilesize 3dc3c373d8828c0dbe4080d584b00c84 SRR5423548.sra SRR5423548.sra file validated SRR5423548 is single end SRR5423548 is conventional basespace SRR5423548 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423548_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.618 31.0 31.0 34.0 30.0 34.0 2 31.85575 33.0 31.0 34.0 30.0 34.0 3 31.99925 34.0 31.0 34.0 30.0 34.0 4 33.227 37.0 33.0 37.0 25.0 37.0 5 34.95525 37.0 35.0 37.0 32.0 37.0 6 35.27125 37.0 35.0 37.0 32.0 37.0 7 35.30125 37.0 35.0 37.0 33.0 37.0 8 35.54675 37.0 35.0 37.0 33.0 37.0 9 37.12175 39.0 37.0 39.0 33.0 39.0 10 37.2645 39.0 37.0 39.0 33.0 39.0 11 37.1495 39.0 37.0 39.0 33.0 39.0 12 37.03775 39.0 37.0 39.0 33.0 39.0 13 37.19125 39.0 37.0 39.0 33.0 39.0 14 38.44475 40.0 38.0 41.0 34.0 41.0 15 38.2725 40.0 38.0 41.0 33.0 41.0 16 38.23525 40.0 38.0 41.0 33.0 41.0 17 38.27425 40.0 37.0 41.0 33.0 41.0 18 38.3605 40.0 38.0 41.0 33.0 41.0 19 38.25525 40.0 38.0 41.0 33.0 41.0 20 38.344 40.0 38.0 41.0 34.0 41.0 21 38.39075 40.0 38.0 41.0 34.0 41.0 22 38.42275 40.0 38.0 41.0 34.0 41.0 23 38.4125 40.0 38.0 41.0 34.0 41.0 24 38.37175 40.0 38.0 41.0 34.0 41.0 25 38.21225 40.0 38.0 41.0 33.0 41.0 26 38.09775 40.0 37.0 41.0 33.0 41.0 27 38.2205 40.0 38.0 41.0 34.0 41.0 28 38.205 40.0 38.0 41.0 33.0 41.0 29 38.03125 40.0 37.0 41.0 33.0 41.0 30 38.17125 40.0 38.0 41.0 33.0 41.0 31 38.2665 40.0 38.0 41.0 34.0 41.0 32 38.0015 40.0 37.0 41.0 33.0 41.0 33 38.02475 40.0 37.0 41.0 33.0 41.0 34 37.96475 40.0 37.0 41.0 33.0 41.0 35 37.9 40.0 37.0 41.0 33.0 41.0 36 38.05325 40.0 37.0 41.0 33.0 41.0 37 37.83875 40.0 37.0 41.0 33.0 41.0 38 37.78175 40.0 37.0 41.0 33.0 41.0 39 37.8135 40.0 37.0 41.0 33.0 41.0 40 37.57875 40.0 37.0 41.0 32.0 41.0 41 37.61175 40.0 37.0 41.0 32.0 41.0 42 37.587 40.0 37.0 41.0 32.0 41.0 43 37.583 40.0 37.0 41.0 32.0 41.0 44 37.48125 40.0 37.0 41.0 32.0 41.0 45 37.18375 39.0 36.0 41.0 31.0 41.0 46 37.3455 39.0 36.0 41.0 31.0 41.0 47 37.24825 39.0 36.0 41.0 31.0 41.0 48 37.272 39.0 36.0 41.0 31.0 41.0 49 37.12575 39.0 36.0 41.0 31.0 41.0 50 37.049 39.0 35.0 41.0 31.0 41.0 51 37.19075 39.0 36.0 41.0 31.0 41.0 52 36.662 38.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1314 1 0.0 1314 2 0.0 1314 3 0.0 1314 4 0.0 1314 5 0.0 1314 6 0.0 1314 7 0.0 1314 8 0.0 1314 9 0.0 1314 10 0.0 1314 11 0.0 1314 12 0.0 1314 13 0.0 1314 14 0.0 1314 15 0.0 1314 16 0.0 1314 17 0.0 1314 18 0.0 1314 19 0.0 1314 20 0.0 1314 21 0.0 1314 22 0.0 1314 23 0.0 1314 24 0.0 1314 25 0.0 1314 26 0.0 1314 27 0.0 1314 28 0.0 1314 29 0.0 1314 30 0.0 1314 31 0.0 1314 32 0.0 1314 33 0.0 1314 34 0.0 1314 35 0.0 1314 36 0.0 1314 37 0.0 1314 38 0.0 1314 39 0.0 1314 40 0.0 1314 41 0.0 1314 42 0.0 1314 43 0.0 1314 44 0.0 1314 45 0.0 1314 46 0.0 1314 47 0.0 1314 48 0.0 1314 49 0.0 1314 50 0.0 1314 51 0.0 1314 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 6.0 24 9.0 25 8.0 26 14.0 27 21.0 28 34.0 29 47.0 30 60.0 31 91.0 32 118.0 33 162.0 34 198.0 35 234.0 36 359.0 37 454.0 38 755.0 39 1421.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.0555833750626 12.193289934902353 9.814722083124687 40.936404606910365 2 20.7 18.65 34.599999999999994 26.05 3 20.625 20.225 25.650000000000002 33.5 4 24.474999999999998 28.925 22.375 24.224999999999998 5 23.95 31.674999999999997 23.95 20.424999999999997 6 19.35 31.525 24.625 24.5 7 15.5 21.975 42.35 20.175 8 19.575 20.525 29.825000000000003 30.075000000000003 9 18.55 19.925 32.324999999999996 29.2 10 18.475 35.449999999999996 24.6 21.475 11 24.25 25.25 20.875 29.625 12 22.95 22.25 25.825 28.975 13 21.275 24.9 27.650000000000002 26.174999999999997 14 22.45 25.1 27.55 24.9 15 21.975 24.7 25.974999999999998 27.35 16 20.7 25.874999999999996 26.3 27.125 17 21.375 25.6 27.825 25.2 18 21.625 24.725 27.3 26.35 19 22.7 26.700000000000003 26.174999999999997 24.425 20 22.525000000000002 25.525 25.7 26.25 21 21.375 24.15 27.275 27.200000000000003 22 22.6 24.675 25.174999999999997 27.55 23 21.85546386596649 23.95598899724931 28.032008002000502 26.156539134783696 24 21.325 24.025 27.400000000000002 27.250000000000004 25 22.75 25.35 25.775 26.125 26 22.3 25.025 26.525 26.150000000000002 27 22.1 25.174999999999997 25.825 26.900000000000002 28 22.725 25.3 25.874999999999996 26.1 29 21.55 25.275 25.674999999999997 27.500000000000004 30 20.724999999999998 25.224999999999998 27.400000000000002 26.650000000000002 31 21.525 25.35 26.775 26.35 32 23.400000000000002 24.349999999999998 26.450000000000003 25.8 33 22.3 24.625 26.424999999999997 26.650000000000002 34 22.6 24.75 25.4 27.250000000000004 35 22.675 24.65 25.7 26.974999999999998 36 22.15 24.325 25.4 28.125 37 21.8 25.174999999999997 26.525 26.5 38 22.5 24.025 26.950000000000003 26.525 39 21.725 23.974999999999998 26.325 27.975 40 22.675 25.624999999999996 25.0 26.700000000000003 41 22.25 24.075 26.1 27.575 42 22.275 24.925 25.900000000000002 26.900000000000002 43 22.1 25.525 25.95 26.424999999999997 44 22.375 25.1 25.6 26.924999999999997 45 22.05 25.55 25.650000000000002 26.75 46 22.930732683170792 25.30632658164541 25.18129532383096 26.581645411352838 47 22.325 24.525 25.900000000000002 27.250000000000004 48 21.8304576144036 23.80595148787197 26.581645411352838 27.781945486371594 49 22.475 25.724999999999998 25.15 26.650000000000002 50 22.05551387846962 24.5311327831958 26.556639159789945 26.85671417854464 51 21.80545136284071 23.980995248812203 26.65666416604151 27.556889222305575 52 23.7 24.15 24.025 28.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 4.0 21 7.0 22 6.5 23 6.0 24 8.0 25 10.0 26 10.5 27 11.0 28 18.5 29 26.0 30 28.5 31 31.0 32 35.5 33 40.0 34 61.5 35 83.0 36 106.0 37 129.0 38 129.5 39 158.0 40 186.0 41 212.0 42 238.0 43 252.5 44 267.0 45 294.0 46 321.0 47 358.0 48 395.0 49 400.5 50 406.0 51 416.0 52 426.0 53 392.0 54 358.0 55 335.0 56 312.0 57 261.5 58 211.0 59 179.5 60 148.0 61 122.5 62 97.0 63 82.0 64 54.5 65 42.0 66 32.5 67 23.0 68 14.0 69 5.0 70 7.0 71 9.0 72 8.0 73 7.0 74 5.5 75 4.0 76 2.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.025 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.0 48 0.025 49 0.0 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.04627249357326 95.35 2 1.5167095115681235 2.9499999999999997 3 0.17994858611825193 0.525 4 0.2056555269922879 0.8 5 0.0 0.0 6 0.0 0.0 7 0.025706940874035987 0.17500000000000002 8 0.025706940874035987 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 8 0.2 No Hit CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTG 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra Read 200000 spots for SRR5423548.sra Written 200000 spots for SRR5423548.sra SRR ids: ['SRR5423548.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mtv18gq6 SRR5423548.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423548 file size 703988 SRR5423548 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423548 SRR5423548_1.fastq Input file: SRR5423548_1.fastq trimmed: SRR5423548-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:39:25 2025 >> started Thu Feb 13 13:39:27 2025 >> done (2.035s) 4000000 reads processed; of these: 162 ( 0.00%) short reads filtered out after trimming by size control 373 ( 0.01%) empty reads filtered out after trimming by size control 3999465 (99.99%) reads available; of these: 54460 ( 1.36%) trimmed reads available after processing 3945005 (98.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 11 0.00% 20 4 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 7 0.00% 28 4 0.00% 29 3 0.00% 30 7 0.00% 31 7 0.00% 32 11 0.00% 33 15 0.00% 34 16 0.00% 35 7 0.00% 36 17 0.00% 37 38 0.00% 38 26 0.00% 39 32 0.00% 40 53 0.00% 41 60 0.00% 42 101 0.00% 43 117 0.00% 44 171 0.00% 45 259 0.01% 46 359 0.01% 47 589 0.01% 48 1033 0.03% 49 2049 0.05% 50 6124 0.15% 51 43324 1.08% 52 3945005 98.64% 3999465 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=11.89 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.4 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:39:40 Started mapping on | Feb 13 13:39:40 Finished on | Feb 13 13:39:47 Mapping speed, Million of reads per hour | 2056.87 Number of input reads | 3999465 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3693502 Uniquely mapped reads % | 92.35% Average mapped length | 51.84 Number of splices: Total | 492338 Number of splices: Annotated (sjdb) | 486272 Number of splices: GT/AG | 482593 Number of splices: GC/AG | 8987 Number of splices: AT/AC | 268 Number of splices: Non-canonical | 490 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.57 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 251291 % of reads mapped to multiple loci | 6.28% Number of reads mapped to too many loci | 40684 % of reads mapped to too many loci | 1.02% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54672 54672 54672 N_multimapping 251291 251291 251291 N_noFeature 123592 3649929 143398 N_ambiguous 43502 45 19716 UnstrandedReadsAssigned:3526408 PositiveStrandReadsAssigned:43528 NegativeStrandReadsAssigned:3530388 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423548 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423548-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,465 reads, 3,666,383 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52401 SRR5423548.ke.tsv 34699 SRR5423548.se.tsv 87100 total ==> SRR5423548.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 85 11.8121 Potri.005G024800.1.v4.1 1035 936 13 3.70383 Potri.004G059700.1.v4.1 961 862 14 4.33116 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 38.5343 3.61327 Potri.016G087400.1.v4.1 270 171 94 146.594 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 41 12.453 ==> SRR5423548.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 66 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5423548 completed mapping pipeline successfully