Starting /dee2/code/volunteer_pipeline.sh SRR5423549 current disk space = 3090520674304 free memory = 1454458384 SRR5423549 SRAfilesize f06d35eabc9e6b723cd517d6e19dc406 SRR5423549.sra SRR5423549.sra file validated SRR5423549 is single end SRR5423549 is conventional basespace SRR5423549 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423549_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22125 34.0 31.0 34.0 30.0 34.0 2 32.38625 34.0 31.0 34.0 30.0 34.0 3 32.40775 34.0 31.0 34.0 30.0 34.0 4 35.759 37.0 35.0 37.0 33.0 37.0 5 35.892 37.0 35.0 37.0 35.0 37.0 6 35.92725 37.0 35.0 37.0 35.0 37.0 7 35.92475 37.0 35.0 37.0 35.0 37.0 8 35.947 37.0 35.0 37.0 35.0 37.0 9 37.6475 39.0 37.0 39.0 35.0 39.0 10 37.587 39.0 37.0 39.0 35.0 39.0 11 37.6615 39.0 37.0 39.0 35.0 39.0 12 37.70325 39.0 37.0 39.0 35.0 39.0 13 37.505 39.0 37.0 39.0 35.0 39.0 14 38.973 40.0 38.0 41.0 36.0 41.0 15 38.71425 40.0 38.0 41.0 34.0 41.0 16 38.628 40.0 38.0 41.0 34.0 41.0 17 38.84525 40.0 38.0 41.0 35.0 41.0 18 38.80575 40.0 38.0 41.0 35.0 41.0 19 38.80975 40.0 38.0 41.0 34.0 41.0 20 38.78525 40.0 38.0 41.0 34.0 41.0 21 38.82425 40.0 38.0 41.0 34.0 41.0 22 38.8645 40.0 38.0 41.0 34.0 41.0 23 38.875 40.0 38.0 41.0 35.0 41.0 24 38.785 40.0 38.0 41.0 35.0 41.0 25 38.75675 40.0 38.0 41.0 35.0 41.0 26 38.89375 40.0 38.0 41.0 35.0 41.0 27 38.88 40.0 38.0 41.0 35.0 41.0 28 38.8075 40.0 38.0 41.0 35.0 41.0 29 38.836 40.0 38.0 41.0 35.0 41.0 30 38.769 40.0 38.0 41.0 35.0 41.0 31 38.776 40.0 38.0 41.0 35.0 41.0 32 38.604 40.0 38.0 41.0 34.0 41.0 33 38.656 40.0 38.0 41.0 34.0 41.0 34 38.597 40.0 38.0 41.0 34.0 41.0 35 38.61025 40.0 38.0 41.0 35.0 41.0 36 38.441 40.0 38.0 41.0 34.0 41.0 37 38.338 40.0 38.0 41.0 34.0 41.0 38 38.29425 40.0 38.0 41.0 33.0 41.0 39 38.344 40.0 38.0 41.0 34.0 41.0 40 38.25875 40.0 38.0 41.0 33.0 41.0 41 38.2205 40.0 38.0 41.0 33.0 41.0 42 38.16975 40.0 38.0 41.0 33.0 41.0 43 37.94 40.0 37.0 41.0 33.0 41.0 44 37.9545 40.0 37.0 41.0 33.0 41.0 45 37.9385 40.0 37.0 41.0 33.0 41.0 46 37.974 40.0 37.0 41.0 33.0 41.0 47 37.932 40.0 37.0 41.0 33.0 41.0 48 37.9115 40.0 37.0 41.0 33.0 41.0 49 37.79425 40.0 37.0 41.0 33.0 41.0 50 37.8375 40.0 37.0 41.0 33.0 41.0 51 37.622 40.0 37.0 41.0 32.0 41.0 52 36.82925 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2110 1 0.0 2110 2 0.0 2110 3 0.0 2110 4 0.0 2110 5 0.0 2110 6 0.0 2110 7 0.0 2110 8 0.0 2110 9 0.0 2110 10 0.0 2110 11 0.0 2110 12 0.0 2110 13 0.0 2110 14 0.0 2110 15 0.0 2110 16 0.0 2110 17 0.0 2110 18 0.0 2110 19 0.0 2110 20 0.0 2110 21 0.0 2110 22 0.0 2110 23 0.0 2110 24 0.0 2110 25 0.0 2110 26 0.0 2110 27 0.0 2110 28 0.0 2110 29 0.0 2110 30 0.0 2110 31 0.0 2110 32 0.0 2110 33 0.0 2110 34 0.0 2110 35 0.0 2110 36 0.0 2110 37 0.0 2110 38 0.0 2110 39 0.0 2110 40 0.0 2110 41 0.0 2110 42 0.0 2110 43 0.0 2110 44 0.0 2110 45 0.0 2110 46 0.0 2110 47 0.0 2110 48 0.0 2110 49 0.0 2110 50 0.0 2110 51 0.0 2110 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 0.0 24 5.0 25 4.0 26 9.0 27 16.0 28 23.0 29 31.0 30 48.0 31 66.0 32 87.0 33 117.0 34 155.0 35 208.0 36 226.0 37 398.0 38 746.0 39 1844.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.639188173390124 11.701327987972938 9.270859433725883 39.38862440491105 2 21.224999999999998 15.925 36.025 26.825 3 20.549999999999997 20.974999999999998 25.424999999999997 33.050000000000004 4 25.724999999999998 27.35 22.125 24.8 5 24.5 32.725 22.725 20.05 6 19.775000000000002 31.275 24.25 24.7 7 15.875 21.025 42.1 21.0 8 18.5 21.3 30.175 30.025000000000002 9 19.5 19.975 32.75 27.775 10 20.025000000000002 34.849999999999994 24.8 20.325 11 24.825 23.9 21.025 30.25 12 23.275000000000002 21.375 26.35 28.999999999999996 13 19.675 25.124999999999996 28.875 26.325 14 20.9 25.174999999999997 28.050000000000004 25.874999999999996 15 20.599999999999998 24.65 27.6 27.150000000000002 16 21.75 25.224999999999998 25.575 27.450000000000003 17 22.400000000000002 24.175 27.500000000000004 25.924999999999997 18 21.825 24.025 27.35 26.8 19 22.825 25.124999999999996 25.2 26.85 20 21.725 25.775 26.650000000000002 25.85 21 22.625 24.825 26.575 25.974999999999998 22 21.55 25.174999999999997 26.424999999999997 26.85 23 20.200000000000003 25.15 27.075 27.575 24 23.05 24.3 25.650000000000002 27.0 25 21.75 25.575 26.275 26.400000000000002 26 21.349999999999998 24.375 27.125 27.150000000000002 27 22.1 23.95 26.125 27.825 28 21.725 25.2 26.275 26.8 29 22.900000000000002 24.75 26.85 25.5 30 21.125 24.224999999999998 27.025 27.625 31 22.3 25.6 24.825 27.275 32 23.125 24.575 26.400000000000002 25.900000000000002 33 22.5 23.724999999999998 26.55 27.224999999999998 34 21.775 25.45 26.224999999999998 26.55 35 22.825 24.3 26.35 26.525 36 23.25 24.099999999999998 26.05 26.6 37 24.2 24.3 24.6 26.900000000000002 38 23.45 24.3 25.95 26.3 39 21.575 24.05 27.075 27.3 40 22.275 24.65 26.474999999999998 26.6 41 23.150000000000002 24.775 26.424999999999997 25.650000000000002 42 22.675 24.425 26.0 26.900000000000002 43 23.7 24.349999999999998 25.1 26.85 44 21.875 24.325 27.05 26.75 45 22.8 24.3 26.125 26.775 46 23.674999999999997 23.599999999999998 25.624999999999996 27.1 47 23.849999999999998 24.175 25.15 26.825 48 22.15 24.325 25.575 27.950000000000003 49 22.55 24.55 27.224999999999998 25.674999999999997 50 22.05 23.974999999999998 25.775 28.199999999999996 51 23.1 23.825 25.874999999999996 27.200000000000003 52 23.125 23.625 26.75 26.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 4.0 24 4.5 25 5.0 26 6.5 27 8.0 28 15.5 29 23.0 30 29.5 31 36.0 32 43.0 33 50.0 34 58.5 35 67.0 36 87.5 37 108.0 38 116.5 39 159.5 40 194.0 41 209.0 42 224.0 43 266.5 44 309.0 45 314.5 46 320.0 47 365.5 48 411.0 49 399.0 50 387.0 51 402.0 52 417.0 53 392.0 54 367.0 55 332.0 56 297.0 57 252.5 58 208.0 59 191.5 60 175.0 61 139.0 62 103.0 63 83.0 64 50.5 65 38.0 66 33.5 67 29.0 68 20.0 69 11.0 70 10.0 71 9.0 72 6.0 73 3.0 74 3.0 75 3.0 76 3.0 77 3.0 78 2.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.72500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 97.44119927629879 94.25 2 1.9643318686999225 3.8 3 0.3876970793486689 1.125 4 0.18092530369604548 0.7000000000000001 5 0.025846471956577927 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra Read 200000 spots for SRR5423549.sra Written 200000 spots for SRR5423549.sra SRR ids: ['SRR5423549.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_do0rwzl6 SRR5423549.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423549 file size 704001 SRR5423549 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423549 SRR5423549_1.fastq Input file: SRR5423549_1.fastq trimmed: SRR5423549-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:43:05 2025 >> started Thu Feb 13 13:43:06 2025 >> done (1.865s) 4000000 reads processed; of these: 162 ( 0.00%) short reads filtered out after trimming by size control 373 ( 0.01%) empty reads filtered out after trimming by size control 3999465 (99.99%) reads available; of these: 60996 ( 1.53%) trimmed reads available after processing 3938469 (98.47%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 13 0.00% 20 8 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 3 0.00% 28 3 0.00% 29 10 0.00% 30 10 0.00% 31 8 0.00% 32 8 0.00% 33 9 0.00% 34 11 0.00% 35 14 0.00% 36 25 0.00% 37 25 0.00% 38 35 0.00% 39 43 0.00% 40 62 0.00% 41 69 0.00% 42 100 0.00% 43 145 0.00% 44 212 0.01% 45 241 0.01% 46 386 0.01% 47 621 0.02% 48 1099 0.03% 49 2335 0.06% 50 7082 0.18% 51 48407 1.21% 52 3938469 98.47% 3999465 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=10.74 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.7 sequence=CTTTGCTCCCAAATCAGTATCGGATGGCTGGACACTCTCAAACACTCCTATGACCTCTCCGGTCTCAGGCTT Started job on | Feb 13 13:43:25 Started mapping on | Feb 13 13:43:25 Finished on | Feb 13 13:43:30 Mapping speed, Million of reads per hour | 2879.61 Number of input reads | 3999465 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3694600 Uniquely mapped reads % | 92.38% Average mapped length | 51.82 Number of splices: Total | 491717 Number of splices: Annotated (sjdb) | 485471 Number of splices: GT/AG | 482061 Number of splices: GC/AG | 8895 Number of splices: AT/AC | 286 Number of splices: Non-canonical | 475 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 250008 % of reads mapped to multiple loci | 6.25% Number of reads mapped to too many loci | 40353 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.36% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54857 54857 54857 N_multimapping 250008 250008 250008 N_noFeature 123814 3651042 143286 N_ambiguous 43590 46 19486 UnstrandedReadsAssigned:3527196 PositiveStrandReadsAssigned:43512 NegativeStrandReadsAssigned:3531828 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423549 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423549-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,465 reads, 3,651,926 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR5423549.ke.tsv 34699 SRR5423549.se.tsv 87100 total ==> SRR5423549.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 88 12.2783 Potri.005G024800.1.v4.1 1035 936 11 3.14664 Potri.004G059700.1.v4.1 961 862 12 3.72739 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 49.2802 4.63953 Potri.016G087400.1.v4.1 270 171 104 162.843 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.159947 Potri.012G127500.1.v4.1 977 878 51 15.5527 ==> SRR5423549.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 80 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR5423549 completed mapping pipeline successfully