Starting /dee2/code/volunteer_pipeline.sh SRR5423550 current disk space = 3090043723776 free memory = 1582122476 SRR5423550 SRAfilesize bb00385d690bebae7c41bee9d3cebf2d SRR5423550.sra SRR5423550.sra file validated SRR5423550 is single end SRR5423550 is conventional basespace SRR5423550 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423550_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54975 34.0 31.0 34.0 31.0 34.0 2 32.68225 34.0 31.0 34.0 31.0 34.0 3 32.74 34.0 31.0 34.0 31.0 34.0 4 36.0905 37.0 37.0 37.0 35.0 37.0 5 36.12825 37.0 37.0 37.0 35.0 37.0 6 36.1175 37.0 36.0 37.0 35.0 37.0 7 36.099 37.0 35.0 37.0 35.0 37.0 8 36.14 37.0 36.0 37.0 35.0 37.0 9 37.779 39.0 38.0 39.0 35.0 39.0 10 37.728 39.0 38.0 39.0 35.0 39.0 11 37.737 39.0 38.0 39.0 35.0 39.0 12 37.84325 39.0 38.0 39.0 35.0 39.0 13 37.85425 39.0 38.0 39.0 35.0 39.0 14 39.27725 41.0 39.0 41.0 36.0 41.0 15 39.226 40.0 39.0 41.0 36.0 41.0 16 39.16875 40.0 39.0 41.0 36.0 41.0 17 39.15525 40.0 39.0 41.0 36.0 41.0 18 39.11425 40.0 39.0 41.0 36.0 41.0 19 39.20025 40.0 39.0 41.0 36.0 41.0 20 39.17425 40.0 39.0 41.0 36.0 41.0 21 39.10625 40.0 39.0 41.0 36.0 41.0 22 39.1565 40.0 39.0 41.0 36.0 41.0 23 39.01675 40.0 39.0 41.0 36.0 41.0 24 39.1475 40.0 39.0 41.0 36.0 41.0 25 39.15175 40.0 39.0 41.0 36.0 41.0 26 38.97975 40.0 39.0 41.0 35.0 41.0 27 38.87 40.0 38.0 41.0 35.0 41.0 28 38.848 40.0 38.0 41.0 35.0 41.0 29 38.7935 40.0 38.0 41.0 35.0 41.0 30 38.727 40.0 38.0 41.0 35.0 41.0 31 38.724 40.0 38.0 41.0 35.0 41.0 32 38.825 40.0 38.0 41.0 35.0 41.0 33 38.845 40.0 39.0 41.0 35.0 41.0 34 38.7565 40.0 38.0 41.0 35.0 41.0 35 38.64575 40.0 38.0 41.0 35.0 41.0 36 38.6635 40.0 38.0 41.0 35.0 41.0 37 38.4555 40.0 38.0 41.0 34.0 41.0 38 38.38325 40.0 38.0 41.0 34.0 41.0 39 38.32925 40.0 38.0 41.0 34.0 41.0 40 38.32475 40.0 38.0 41.0 34.0 41.0 41 38.24225 40.0 38.0 41.0 33.0 41.0 42 38.257 40.0 38.0 41.0 34.0 41.0 43 38.1895 40.0 38.0 41.0 33.0 41.0 44 37.879 40.0 38.0 41.0 33.0 41.0 45 37.734 40.0 37.0 41.0 32.0 41.0 46 37.9295 40.0 38.0 41.0 33.0 41.0 47 37.90225 40.0 38.0 41.0 33.0 41.0 48 37.8875 40.0 37.0 41.0 33.0 41.0 49 37.756 40.0 37.0 41.0 33.0 41.0 50 37.674 40.0 37.0 41.0 32.0 41.0 51 37.62625 40.0 37.0 41.0 32.0 41.0 52 36.436 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2205 1 0.0 2205 2 0.0 2205 3 0.0 2205 4 0.0 2205 5 0.0 2205 6 0.0 2205 7 0.0 2205 8 0.0 2205 9 0.0 2205 10 0.0 2205 11 0.0 2205 12 0.0 2205 13 0.0 2205 14 0.0 2205 15 0.0 2205 16 0.0 2205 17 0.0 2205 18 0.0 2205 19 0.0 2205 20 0.0 2205 21 0.0 2205 22 0.0 2205 23 0.0 2205 24 0.0 2205 25 0.0 2205 26 0.0 2205 27 0.0 2205 28 0.0 2205 29 0.0 2205 30 0.0 2205 31 0.0 2205 32 0.0 2205 33 0.0 2205 34 0.0 2205 35 0.0 2205 36 0.0 2205 37 0.0 2205 38 0.0 2205 39 0.0 2205 40 0.0 2205 41 0.0 2205 42 0.0 2205 43 0.0 2205 44 0.0 2205 45 0.0 2205 46 0.0 2205 47 0.0 2205 48 0.0 2205 49 0.0 2205 50 0.0 2205 51 0.0 2205 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 0.0 20 0.0 21 1.0 22 3.0 23 4.0 24 1.0 25 12.0 26 10.0 27 17.0 28 22.0 29 31.0 30 38.0 31 59.0 32 60.0 33 89.0 34 131.0 35 181.0 36 229.0 37 375.0 38 701.0 39 2032.0 40 2.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.11511511511511 10.66066066066066 8.75875875875876 40.46546546546546 2 24.0 15.75 35.5 24.75 3 21.325 20.45 25.0 33.225 4 24.15 28.499999999999996 22.1 25.25 5 23.674999999999997 32.375 23.075000000000003 20.875 6 19.85 32.35 24.875 22.925 7 16.1 22.325 40.925 20.65 8 19.25 21.45 29.9 29.4 9 19.275000000000002 20.75 31.874999999999996 28.1 10 19.8 36.275 22.45 21.475 11 25.025 26.900000000000002 19.950000000000003 28.125 12 22.525000000000002 22.8 25.75 28.925 13 21.575 24.875 28.15 25.4 14 20.575 25.924999999999997 27.55 25.95 15 21.475 25.174999999999997 27.224999999999998 26.125 16 22.275 25.25 26.900000000000002 25.575 17 22.525000000000002 25.224999999999998 26.125 26.125 18 21.65 24.425 26.174999999999997 27.750000000000004 19 21.9 25.75 26.275 26.075 20 21.675 24.65 27.200000000000003 26.474999999999998 21 21.15 25.25 26.8 26.8 22 22.85 24.975 25.650000000000002 26.525 23 22.625 26.424999999999997 25.624999999999996 25.324999999999996 24 22.55 24.625 26.174999999999997 26.650000000000002 25 22.375 24.65 25.55 27.425 26 22.925 24.925 27.0 25.15 27 21.675 23.5 27.0 27.825 28 23.200000000000003 25.6 24.625 26.575 29 22.625 24.675 26.150000000000002 26.55 30 21.9 24.9 25.85 27.35 31 21.725 26.775 23.849999999999998 27.650000000000002 32 22.625 25.45 25.3 26.625 33 22.25 23.125 27.425 27.200000000000003 34 22.55 24.474999999999998 26.174999999999997 26.8 35 22.400000000000002 24.925 27.275 25.4 36 22.55 24.95 25.650000000000002 26.85 37 22.35 25.8 25.525 26.325 38 22.575 24.8 27.075 25.55 39 21.85 24.025 26.174999999999997 27.950000000000003 40 22.85 23.799999999999997 25.5 27.85 41 21.4 25.025 26.950000000000003 26.625 42 22.025 24.425 26.424999999999997 27.125 43 22.5 24.625 25.1 27.775 44 22.25 25.650000000000002 25.474999999999998 26.625 45 22.0 25.724999999999998 26.35 25.924999999999997 46 23.05 25.6 25.174999999999997 26.174999999999997 47 23.200000000000003 24.625 25.924999999999997 26.25 48 22.975 24.099999999999998 24.75 28.175 49 22.8 24.65 26.3 26.25 50 24.075 23.575 25.224999999999998 27.125 51 21.925 24.45 26.325 27.3 52 24.6 23.95 25.55 25.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 2.0 18 2.0 19 2.0 20 2.0 21 2.0 22 2.0 23 2.0 24 2.5 25 3.0 26 8.5 27 14.0 28 16.5 29 19.0 30 29.5 31 40.0 32 49.0 33 58.0 34 68.0 35 78.0 36 85.0 37 92.0 38 105.5 39 137.5 40 156.0 41 206.0 42 256.0 43 283.5 44 311.0 45 331.0 46 351.0 47 367.5 48 384.0 49 389.5 50 395.0 51 396.0 52 397.0 53 388.0 54 379.0 55 342.0 56 305.0 57 267.0 58 229.0 59 192.0 60 155.0 61 128.5 62 102.0 63 87.0 64 53.5 65 35.0 66 25.0 67 15.0 68 13.5 69 12.0 70 8.5 71 5.0 72 4.5 73 4.0 74 3.5 75 3.0 76 2.0 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.8 #Duplication Level Percentage of deduplicated Percentage of total 1 97.41735537190083 94.3 2 2.1177685950413223 4.1000000000000005 3 0.3357438016528926 0.975 4 0.05165289256198347 0.2 5 0.05165289256198347 0.25 6 0.0 0.0 7 0.025826446280991736 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 7 0.17500000000000002 No Hit GCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGG 5 0.125 No Hit CTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra Read 200000 spots for SRR5423550.sra Written 200000 spots for SRR5423550.sra SRR ids: ['SRR5423550.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_12awtrpw SRR5423550.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423550 file size 703955 SRR5423550 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423550 SRR5423550_1.fastq Input file: SRR5423550_1.fastq trimmed: SRR5423550-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:07:22 2025 >> started Thu Feb 13 14:07:24 2025 >> done (1.906s) 4000000 reads processed; of these: 154 ( 0.00%) short reads filtered out after trimming by size control 355 ( 0.01%) empty reads filtered out after trimming by size control 3999491 (99.99%) reads available; of these: 55307 ( 1.38%) trimmed reads available after processing 3944184 (98.62%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 2 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 0 0.00% 29 2 0.00% 30 7 0.00% 31 5 0.00% 32 7 0.00% 33 12 0.00% 34 5 0.00% 35 11 0.00% 36 18 0.00% 37 16 0.00% 38 25 0.00% 39 32 0.00% 40 49 0.00% 41 56 0.00% 42 70 0.00% 43 92 0.00% 44 133 0.00% 45 218 0.01% 46 317 0.01% 47 478 0.01% 48 897 0.02% 49 1907 0.05% 50 5926 0.15% 51 44995 1.13% 52 3944184 98.62% 3999491 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.18 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=15 fanout-score=14.71 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=5.2 sequence=CAGCCTTGACAAATGGACCTACGAGGAGGAAGCCATGGGCCAGCCCCACCTCGATTCCGCGGAGAAGTGGACTGACTGCTGTCCTGTAGGCGGGGAGGTTGGACAGGTACCATGCAATCAGCGGGCTTGATGTAACGGGAGTCTCAAGACTTCCAATGAAGGGATCGCCATTGATTGGTTGAACCACTTGGTAAGTTGGCTTGTCTGCTTGAACGGCTTTGACAGTGAAGCTTCTCTTGTTGGGCGAAACTCTAAATGGAGCTCCAGAAATGCCTCTGG Started job on | Feb 13 14:07:37 Started mapping on | Feb 13 14:07:37 Finished on | Feb 13 14:07:41 Mapping speed, Million of reads per hour | 3599.54 Number of input reads | 3999491 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3696724 Uniquely mapped reads % | 92.43% Average mapped length | 51.84 Number of splices: Total | 492447 Number of splices: Annotated (sjdb) | 486323 Number of splices: GT/AG | 482682 Number of splices: GC/AG | 9031 Number of splices: AT/AC | 262 Number of splices: Non-canonical | 472 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.00% Deletion average length | 1.59 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 248949 % of reads mapped to multiple loci | 6.22% Number of reads mapped to too many loci | 40277 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.33% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 53818 53818 53818 N_multimapping 248949 248949 248949 N_noFeature 124299 3653490 143934 N_ambiguous 43076 35 19457 UnstrandedReadsAssigned:3529349 PositiveStrandReadsAssigned:43199 NegativeStrandReadsAssigned:3533333 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423550 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423550-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,491 reads, 3,665,250 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR5423550.ke.tsv 34699 SRR5423550.se.tsv 87100 total ==> SRR5423550.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 104 14.4645 Potri.005G024800.1.v4.1 1035 936 17 4.8475 Potri.004G059700.1.v4.1 961 862 18 5.57327 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 42.5792 3.99588 Potri.016G087400.1.v4.1 270 171 91 142.033 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 1 0.159437 Potri.012G127500.1.v4.1 977 878 43 13.0713 ==> SRR5423550.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 64 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR5423550 completed mapping pipeline successfully