Starting /dee2/code/volunteer_pipeline.sh SRR5423551 current disk space = 3090359779328 free memory = 1455001772 SRR5423551 SRAfilesize 8043053eea20c0e626268b18bfdb1134 SRR5423551.sra SRR5423551.sra file validated SRR5423551 is single end SRR5423551 is conventional basespace SRR5423551 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423551_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.39575 31.0 30.0 33.0 27.0 34.0 2 31.20825 31.0 31.0 34.0 28.0 34.0 3 31.197 31.0 31.0 34.0 27.0 34.0 4 31.64725 35.0 30.0 37.0 19.0 37.0 5 32.9305 35.0 32.0 37.0 25.0 37.0 6 34.14475 35.0 33.0 37.0 29.0 37.0 7 35.03625 35.0 35.0 37.0 32.0 37.0 8 35.1025 36.0 35.0 37.0 32.0 37.0 9 36.86675 39.0 37.0 39.0 33.0 39.0 10 36.693 39.0 35.0 39.0 32.0 39.0 11 36.889 39.0 37.0 39.0 33.0 39.0 12 36.8705 39.0 37.0 39.0 33.0 39.0 13 36.804 39.0 37.0 39.0 33.0 39.0 14 37.958 40.0 37.0 41.0 33.0 41.0 15 37.89325 40.0 37.0 41.0 33.0 41.0 16 37.9535 40.0 37.0 41.0 33.0 41.0 17 38.012 40.0 37.0 41.0 33.0 41.0 18 37.95775 40.0 37.0 41.0 33.0 41.0 19 38.12625 40.0 37.0 41.0 33.0 41.0 20 38.0815 40.0 37.0 41.0 33.0 41.0 21 38.16475 40.0 37.0 41.0 33.0 41.0 22 38.141 40.0 37.0 41.0 33.0 41.0 23 38.141 40.0 37.0 41.0 34.0 41.0 24 38.09575 40.0 37.0 41.0 33.0 41.0 25 38.24225 40.0 38.0 41.0 34.0 41.0 26 37.96075 40.0 37.0 41.0 33.0 41.0 27 38.13775 40.0 38.0 41.0 33.0 41.0 28 37.848 40.0 37.0 41.0 32.0 41.0 29 37.99025 40.0 37.0 41.0 33.0 41.0 30 37.84475 40.0 37.0 41.0 33.0 41.0 31 37.6695 40.0 37.0 41.0 32.0 41.0 32 37.74825 40.0 37.0 41.0 33.0 41.0 33 37.527 40.0 37.0 41.0 32.0 41.0 34 37.69325 40.0 37.0 41.0 33.0 41.0 35 37.85225 40.0 37.0 41.0 33.0 41.0 36 37.5855 40.0 37.0 41.0 32.0 41.0 37 37.46575 40.0 37.0 41.0 31.0 41.0 38 37.1525 39.0 36.0 41.0 30.0 41.0 39 37.27025 39.0 36.0 41.0 31.0 41.0 40 37.178 39.0 36.0 41.0 31.0 41.0 41 37.157 39.0 36.0 40.0 31.0 41.0 42 37.2885 39.0 36.0 41.0 31.0 41.0 43 36.9645 39.0 36.0 40.0 30.0 41.0 44 36.78975 39.0 35.0 40.0 30.0 41.0 45 36.77275 39.0 35.0 40.0 30.0 41.0 46 36.80175 39.0 35.0 40.0 30.0 41.0 47 36.765 39.0 35.0 40.0 30.0 41.0 48 36.82075 39.0 35.0 40.0 30.0 41.0 49 36.5535 39.0 35.0 40.0 30.0 41.0 50 36.76525 39.0 35.0 40.0 30.0 41.0 51 36.712 39.0 35.0 40.0 30.0 41.0 52 36.13175 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2216 1 0.0 2216 2 0.0 2216 3 0.0 2216 4 0.0 2216 5 0.0 2216 6 0.0 2216 7 0.0 2216 8 0.0 2216 9 0.0 2216 10 0.0 2216 11 0.0 2216 12 0.0 2216 13 0.0 2216 14 0.0 2216 15 0.0 2216 16 0.0 2216 17 0.0 2216 18 0.0 2216 19 0.0 2216 20 0.0 2216 21 0.0 2216 22 0.0 2216 23 0.0 2216 24 0.0 2216 25 0.0 2216 26 0.0 2216 27 0.0 2216 28 0.0 2216 29 0.0 2216 30 0.0 2216 31 0.0 2216 32 0.0 2216 33 0.0 2216 34 0.0 2216 35 0.0 2216 36 0.0 2216 37 0.0 2216 38 0.0 2216 39 0.0 2216 40 0.0 2216 41 0.0 2216 42 0.0 2216 43 0.0 2216 44 0.0 2216 45 0.0 2216 46 0.0 2216 47 0.0 2216 48 0.0 2216 49 0.0 2216 50 0.0 2216 51 0.0 2216 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 2.0 22 6.0 23 5.0 24 10.0 25 14.0 26 17.0 27 28.0 28 42.0 29 64.0 30 81.0 31 103.0 32 137.0 33 164.0 34 218.0 35 291.0 36 416.0 37 527.0 38 808.0 39 1063.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.42807105328997 11.908931698774081 9.156867650738054 41.5061295971979 2 22.075 17.0 36.175000000000004 24.75 3 21.8 20.375 25.4 32.425 4 25.825 26.35 23.075000000000003 24.75 5 23.35 32.7 24.0 19.950000000000003 6 18.224999999999998 32.324999999999996 25.6 23.849999999999998 7 16.55 20.8 42.199999999999996 20.45 8 19.950000000000003 20.599999999999998 29.975 29.475 9 19.2 19.225 32.85 28.725 10 19.625 36.575 23.625 20.175 11 23.825 24.9 21.575 29.7 12 22.95 21.275 25.124999999999996 30.65 13 20.325 24.575 27.150000000000002 27.950000000000003 14 21.45 25.724999999999998 29.075 23.75 15 21.275 24.224999999999998 28.1 26.400000000000002 16 21.7 25.825 26.650000000000002 25.825 17 23.075000000000003 25.2 25.724999999999998 26.0 18 22.85 25.025 26.525 25.6 19 22.725 25.374999999999996 26.8 25.1 20 22.975 25.674999999999997 27.0 24.349999999999998 21 22.075 24.224999999999998 26.674999999999997 27.025 22 22.5 24.9 26.200000000000003 26.400000000000002 23 22.325 25.1 27.474999999999998 25.1 24 21.55 25.3 26.575 26.575 25 21.6 26.325 25.7 26.375 26 22.075 25.1 26.974999999999998 25.85 27 20.8 25.5 26.5 27.200000000000003 28 22.35 26.075 25.650000000000002 25.924999999999997 29 22.8 24.6 25.7 26.900000000000002 30 20.825 24.775 26.25 28.15 31 20.275000000000002 25.15 26.575 28.000000000000004 32 22.775000000000002 26.150000000000002 26.150000000000002 24.925 33 21.4 23.05 27.35 28.199999999999996 34 21.95 24.65 25.874999999999996 27.525 35 22.85 24.3 25.95 26.900000000000002 36 21.95 24.675 25.525 27.85 37 22.75 25.374999999999996 25.6 26.275 38 24.099999999999998 23.674999999999997 26.325 25.900000000000002 39 22.45 26.0 25.074999999999996 26.474999999999998 40 22.575 25.900000000000002 26.200000000000003 25.324999999999996 41 23.125 24.45 25.45 26.974999999999998 42 23.025000000000002 23.65 26.025 27.3 43 21.975 25.474999999999998 25.374999999999996 27.175 44 22.400000000000002 23.625 27.875 26.1 45 22.1 24.7 26.950000000000003 26.25 46 23.05 25.724999999999998 24.45 26.775 47 22.025 25.35 26.400000000000002 26.224999999999998 48 21.6 24.85 26.275 27.275 49 22.625 24.825 24.7 27.85 50 22.975 24.775 25.45 26.8 51 23.325000000000003 23.525 26.275 26.875 52 22.975 24.675 25.55 26.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.5 21 3.0 22 6.5 23 10.0 24 8.0 25 6.0 26 9.5 27 13.0 28 18.0 29 23.0 30 22.5 31 22.0 32 39.0 33 56.0 34 68.5 35 81.0 36 101.0 37 121.0 38 132.0 39 156.5 40 170.0 41 206.0 42 242.0 43 274.5 44 307.0 45 340.0 46 373.0 47 371.5 48 370.0 49 377.0 50 384.0 51 382.0 52 380.0 53 373.0 54 366.0 55 333.0 56 300.0 57 260.0 58 220.0 59 187.5 60 155.0 61 130.0 62 105.0 63 82.5 64 50.0 65 40.0 66 27.5 67 15.0 68 14.0 69 13.0 70 10.0 71 7.0 72 6.0 73 5.0 74 5.5 75 6.0 76 3.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 98.10305049987183 95.675 2 1.5380671622660855 3.0 3 0.23071007433991286 0.675 4 0.07690335811330429 0.3 5 0.0 0.0 6 0.02563445270443476 0.15 7 0.0 0.0 8 0.02563445270443476 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 8 0.2 No Hit GTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra Read 200000 spots for SRR5423551.sra Written 200000 spots for SRR5423551.sra SRR ids: ['SRR5423551.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ime_511s SRR5423551.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423551 file size 703970 SRR5423551 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423551 SRR5423551_1.fastq Input file: SRR5423551_1.fastq trimmed: SRR5423551-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:48:42 2025 >> started Thu Feb 13 13:48:44 2025 >> done (1.977s) 4000000 reads processed; of these: 171 ( 0.00%) short reads filtered out after trimming by size control 394 ( 0.01%) empty reads filtered out after trimming by size control 3999435 (99.99%) reads available; of these: 59511 ( 1.49%) trimmed reads available after processing 3939924 (98.51%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 7 0.00% 20 9 0.00% 21 0 0.00% 22 3 0.00% 23 2 0.00% 24 1 0.00% 25 1 0.00% 26 1 0.00% 27 4 0.00% 28 2 0.00% 29 3 0.00% 30 8 0.00% 31 7 0.00% 32 12 0.00% 33 13 0.00% 34 21 0.00% 35 17 0.00% 36 24 0.00% 37 26 0.00% 38 27 0.00% 39 50 0.00% 40 52 0.00% 41 65 0.00% 42 71 0.00% 43 124 0.00% 44 197 0.00% 45 289 0.01% 46 463 0.01% 47 620 0.02% 48 1069 0.03% 49 2364 0.06% 50 6765 0.17% 51 47186 1.18% 52 3939924 98.51% 3999435 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=12.08 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=1.3 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTC Started job on | Feb 13 13:48:54 Started mapping on | Feb 13 13:48:54 Finished on | Feb 13 13:49:00 Mapping speed, Million of reads per hour | 2399.66 Number of input reads | 3999435 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3695279 Uniquely mapped reads % | 92.40% Average mapped length | 51.84 Number of splices: Total | 492321 Number of splices: Annotated (sjdb) | 486096 Number of splices: GT/AG | 482708 Number of splices: GC/AG | 8858 Number of splices: AT/AC | 263 Number of splices: Non-canonical | 492 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.00% Deletion average length | 1.60 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249678 % of reads mapped to multiple loci | 6.24% Number of reads mapped to too many loci | 40263 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.35% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 54478 54478 54478 N_multimapping 249678 249678 249678 N_noFeature 123941 3651967 143597 N_ambiguous 43237 40 19563 UnstrandedReadsAssigned:3528101 PositiveStrandReadsAssigned:43272 NegativeStrandReadsAssigned:3532119 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423551 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423551-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,435 reads, 3,656,506 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR5423551.ke.tsv 34699 SRR5423551.se.tsv 87100 total ==> SRR5423551.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 90 12.5586 Potri.005G024800.1.v4.1 1035 936 10 2.86087 Potri.004G059700.1.v4.1 961 862 10 3.10647 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 43.3075 4.07763 Potri.016G087400.1.v4.1 270 171 96 150.331 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 43 13.1144 ==> SRR5423551.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 72 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR5423551 completed mapping pipeline successfully