Starting /dee2/code/volunteer_pipeline.sh SRR5423552 current disk space = 3090489110528 free memory = 1408783688 SRR5423552 SRAfilesize 763a8559b400cafb66640369f8780294 SRR5423552.sra SRR5423552.sra file validated SRR5423552 is single end SRR5423552 is conventional basespace SRR5423552 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423552_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.8415 31.0 31.0 34.0 30.0 34.0 2 32.02675 33.0 31.0 34.0 30.0 34.0 3 32.19575 34.0 31.0 34.0 30.0 34.0 4 34.1895 37.0 35.0 37.0 28.0 37.0 5 35.236 37.0 35.0 37.0 32.0 37.0 6 35.53025 37.0 35.0 37.0 33.0 37.0 7 35.55575 37.0 35.0 37.0 33.0 37.0 8 35.7585 37.0 35.0 37.0 33.0 37.0 9 37.4305 39.0 37.0 39.0 34.0 39.0 10 37.26125 39.0 37.0 39.0 33.0 39.0 11 37.30825 39.0 37.0 39.0 33.0 39.0 12 37.38175 39.0 37.0 39.0 34.0 39.0 13 37.3545 39.0 37.0 39.0 34.0 39.0 14 38.67475 40.0 38.0 41.0 34.0 41.0 15 38.5755 40.0 38.0 41.0 34.0 41.0 16 38.54125 40.0 38.0 41.0 34.0 41.0 17 38.58725 40.0 38.0 41.0 34.0 41.0 18 38.48 40.0 38.0 41.0 34.0 41.0 19 38.4095 40.0 38.0 41.0 34.0 41.0 20 38.3515 40.0 38.0 41.0 34.0 41.0 21 38.57325 40.0 38.0 41.0 34.0 41.0 22 38.654 40.0 38.0 41.0 34.0 41.0 23 38.6785 40.0 38.0 41.0 34.0 41.0 24 38.6065 40.0 38.0 41.0 34.0 41.0 25 38.553 40.0 38.0 41.0 34.0 41.0 26 38.60025 40.0 38.0 41.0 34.0 41.0 27 38.32525 40.0 38.0 41.0 34.0 41.0 28 38.16175 40.0 38.0 41.0 33.0 41.0 29 38.20725 40.0 38.0 41.0 33.0 41.0 30 38.1955 40.0 38.0 41.0 33.0 41.0 31 38.26725 40.0 38.0 41.0 34.0 41.0 32 38.283 40.0 38.0 41.0 34.0 41.0 33 37.778 40.0 37.0 41.0 32.0 41.0 34 37.92975 40.0 37.0 41.0 33.0 41.0 35 37.959 40.0 37.0 41.0 33.0 41.0 36 38.20475 40.0 38.0 41.0 34.0 41.0 37 38.064 40.0 38.0 41.0 33.0 41.0 38 37.95425 40.0 37.0 41.0 33.0 41.0 39 37.89725 40.0 37.0 41.0 33.0 41.0 40 37.934 40.0 37.0 41.0 33.0 41.0 41 37.9625 40.0 37.0 41.0 33.0 41.0 42 37.7525 40.0 37.0 41.0 32.0 41.0 43 37.80325 40.0 37.0 41.0 33.0 41.0 44 37.68325 40.0 37.0 41.0 32.0 41.0 45 37.53525 40.0 37.0 41.0 32.0 41.0 46 37.47475 40.0 37.0 41.0 31.0 41.0 47 37.49 40.0 37.0 41.0 32.0 41.0 48 37.5345 40.0 37.0 41.0 32.0 41.0 49 37.494 40.0 37.0 41.0 32.0 41.0 50 37.10675 39.0 36.0 41.0 31.0 41.0 51 37.22825 39.0 36.0 41.0 31.0 41.0 52 36.43 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2311 1 0.0 2311 2 0.0 2311 3 0.0 2311 4 0.0 2311 5 0.0 2311 6 0.0 2311 7 0.0 2311 8 0.0 2311 9 0.0 2311 10 0.0 2311 11 0.0 2311 12 0.0 2311 13 0.0 2311 14 0.0 2311 15 0.0 2311 16 0.0 2311 17 0.0 2311 18 0.0 2311 19 0.0 2311 20 0.0 2311 21 0.0 2311 22 0.0 2311 23 0.0 2311 24 0.0 2311 25 0.0 2311 26 0.0 2311 27 0.0 2311 28 0.0 2311 29 0.0 2311 30 0.0 2311 31 0.0 2311 32 0.0 2311 33 0.0 2311 34 0.0 2311 35 0.0 2311 36 0.0 2311 37 0.0 2311 38 0.0 2311 39 0.0 2311 40 0.0 2311 41 0.0 2311 42 0.0 2311 43 0.0 2311 44 0.0 2311 45 0.0 2311 46 0.0 2311 47 0.0 2311 48 0.0 2311 49 0.0 2311 50 0.0 2311 51 0.0 2311 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 3.0 24 4.0 25 7.0 26 18.0 27 25.0 28 32.0 29 36.0 30 64.0 31 78.0 32 113.0 33 128.0 34 166.0 35 242.0 36 302.0 37 441.0 38 748.0 39 1584.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.084521130282575 11.627906976744185 8.752188047011753 41.53538384596149 2 21.875 16.950000000000003 33.725 27.450000000000003 3 20.849999999999998 21.025 24.425 33.7 4 24.825 28.65 22.725 23.799999999999997 5 24.5 31.2 23.724999999999998 20.575 6 19.1 32.725 24.75 23.425 7 16.45 20.375 41.75 21.425 8 17.549999999999997 21.925 30.625000000000004 29.9 9 19.1 19.725 32.875 28.299999999999997 10 19.900000000000002 36.025 22.775000000000002 21.3 11 24.95 24.325 22.15 28.575 12 24.325 21.55 24.8 29.325000000000003 13 19.675 26.25 28.249999999999996 25.825 14 21.05 24.925 27.775 26.25 15 21.525 25.275 26.825 26.375 16 21.15 26.05 26.974999999999998 25.825 17 21.425 25.15 28.125 25.3 18 22.1 23.849999999999998 26.325 27.725 19 23.225 24.099999999999998 26.674999999999997 26.0 20 23.200000000000003 25.374999999999996 25.900000000000002 25.525 21 22.650000000000002 25.05 26.150000000000002 26.150000000000002 22 21.475 26.200000000000003 26.1 26.224999999999998 23 20.5 25.324999999999996 27.200000000000003 26.974999999999998 24 21.575 26.25 25.674999999999997 26.5 25 22.375 25.575 25.35 26.700000000000003 26 22.025 24.875 26.625 26.474999999999998 27 21.224999999999998 24.3 26.674999999999997 27.800000000000004 28 21.025 25.1 26.400000000000002 27.474999999999998 29 21.625 25.525 27.325 25.525 30 20.1 26.1 27.1 26.700000000000003 31 21.925 25.45 27.05 25.575 32 23.05 25.6 26.3 25.05 33 22.625 24.25 26.6 26.525 34 21.85 25.724999999999998 26.400000000000002 26.025 35 23.5 23.175 27.175 26.150000000000002 36 21.425 25.224999999999998 26.1 27.250000000000004 37 22.55 24.9 26.025 26.525 38 23.0 24.15 26.974999999999998 25.874999999999996 39 21.95 23.9 26.525 27.625 40 22.3 25.6 26.05 26.05 41 22.925 25.174999999999997 26.375 25.525 42 22.400000000000002 24.175 26.525 26.900000000000002 43 22.35 24.075 26.400000000000002 27.175 44 22.375 24.525 26.55 26.55 45 24.125 23.799999999999997 25.75 26.325 46 23.625 24.725 24.625 27.025 47 23.225 24.875 25.55 26.35 48 21.5 23.974999999999998 26.724999999999998 27.800000000000004 49 24.125 24.45 25.474999999999998 25.95 50 22.55 23.599999999999998 26.075 27.775 51 21.224999999999998 24.4 25.95 28.425 52 22.45 25.55 25.4 26.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 1.5 21 1.0 22 3.0 23 5.0 24 7.0 25 9.0 26 11.0 27 13.0 28 20.0 29 27.0 30 30.0 31 33.0 32 43.0 33 53.0 34 66.5 35 80.0 36 89.0 37 98.0 38 126.0 39 169.0 40 184.0 41 217.5 42 251.0 43 275.0 44 299.0 45 318.0 46 337.0 47 364.5 48 392.0 49 379.0 50 366.0 51 379.5 52 393.0 53 403.5 54 414.0 55 346.5 56 279.0 57 245.5 58 212.0 59 185.5 60 159.0 61 122.0 62 85.0 63 75.0 64 51.5 65 38.0 66 27.5 67 17.0 68 14.5 69 12.0 70 10.5 71 9.0 72 8.0 73 7.0 74 4.0 75 1.0 76 1.5 77 2.0 78 2.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.375 #Duplication Level Percentage of deduplicated Percentage of total 1 98.04878048780488 95.475 2 1.540436456996149 3.0 3 0.23106546854942236 0.675 4 0.10269576379974327 0.4 5 0.0 0.0 6 0.07702182284980745 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTG 6 0.15 No Hit GTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCC 6 0.15 No Hit GTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103052 spots for SRR5423552.sra Written 103052 spots for SRR5423552.sra Read 103061 spots for SRR5423552.sra Written 103061 spots for SRR5423552.sra SRR ids: ['SRR5423552.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x7lcsc04 SRR5423552.sra spots: 2061049 blocks: [[1, 103052], [103053, 206104], [206105, 309156], [309157, 412208], [412209, 515260], [515261, 618312], [618313, 721364], [721365, 824416], [824417, 927468], [927469, 1030520], [1030521, 1133572], [1133573, 1236624], [1236625, 1339676], [1339677, 1442728], [1442729, 1545780], [1545781, 1648832], [1648833, 1751884], [1751885, 1854936], [1854937, 1957988], [1957989, 2061049]] SRR5423552 file size 362207 SRR5423552 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423552 SRR5423552_1.fastq Input file: SRR5423552_1.fastq trimmed: SRR5423552-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:44:13 2025 >> started Thu Feb 13 13:44:14 2025 >> done (1.005s) 2061049 reads processed; of these: 75 ( 0.00%) short reads filtered out after trimming by size control 184 ( 0.01%) empty reads filtered out after trimming by size control 2060790 (99.99%) reads available; of these: 29000 ( 1.41%) trimmed reads available after processing 2031790 (98.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 0 0.00% 22 0 0.00% 23 2 0.00% 24 0 0.00% 25 0 0.00% 26 1 0.00% 27 0 0.00% 28 0 0.00% 29 1 0.00% 30 0 0.00% 31 0 0.00% 32 4 0.00% 33 2 0.00% 34 10 0.00% 35 5 0.00% 36 4 0.00% 37 9 0.00% 38 10 0.00% 39 10 0.00% 40 15 0.00% 41 19 0.00% 42 27 0.00% 43 48 0.00% 44 56 0.00% 45 74 0.00% 46 118 0.01% 47 190 0.01% 48 405 0.02% 49 861 0.04% 50 3076 0.15% 51 24045 1.17% 52 2031790 98.59% 2060790 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=34 prefix-density=0.18 prefix-fanout=2.0 sequence=GTGGCATATGCCCAGGCGTTGTTGTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=11.50 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=2.6 sequence=CTTTGCTCCCAAATCAGTATCGGATGGCTGGACACTCTCAAACACTCCTATGACCTCTCCGGTCTCAGGCTT Started job on | Feb 13 13:44:28 Started mapping on | Feb 13 13:44:28 Finished on | Feb 13 13:44:32 Mapping speed, Million of reads per hour | 1854.71 Number of input reads | 2060790 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 1904687 Uniquely mapped reads % | 92.43% Average mapped length | 51.83 Number of splices: Total | 253229 Number of splices: Annotated (sjdb) | 250144 Number of splices: GT/AG | 248333 Number of splices: GC/AG | 4515 Number of splices: AT/AC | 133 Number of splices: Non-canonical | 248 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.00% Deletion average length | 1.55 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 128055 % of reads mapped to multiple loci | 6.21% Number of reads mapped to too many loci | 20907 % of reads mapped to too many loci | 1.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.34% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 28048 28048 28048 N_multimapping 128055 128055 128055 N_noFeature 65164 1882159 75181 N_ambiguous 22495 20 9977 UnstrandedReadsAssigned:1817028 PositiveStrandReadsAssigned:22508 NegativeStrandReadsAssigned:1819529 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423552 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423552-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 2,060,790 reads, 1,882,448 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,046 rounds 52401 SRR5423552.ke.tsv 34699 SRR5423552.se.tsv 87100 total ==> SRR5423552.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 52 14.0501 Potri.005G024800.1.v4.1 1035 936 8 4.43164 Potri.004G059700.1.v4.1 961 862 3 1.80453 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 16.6549 3.03642 Potri.016G087400.1.v4.1 270 171 56 169.802 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 0 0 Potri.012G127500.1.v4.1 977 878 24 14.1732 ==> SRR5423552.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 41 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR5423552 completed mapping pipeline successfully