Starting /dee2/code/volunteer_pipeline.sh SRR5423553 current disk space = 3090579853312 free memory = 1449047708 SRR5423553 SRAfilesize 7c87167be163773a1eb1e1016537fc63 SRR5423553.sra SRR5423553.sra file validated SRR5423553 is single end SRR5423553 is conventional basespace SRR5423553 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423553_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.7545 34.0 31.0 34.0 2.0 34.0 2 31.28275 34.0 31.0 34.0 19.0 34.0 3 32.45075 34.0 31.0 34.0 28.0 34.0 4 36.0165 37.0 35.0 37.0 35.0 37.0 5 36.12425 37.0 35.0 37.0 35.0 37.0 6 36.22225 37.0 37.0 37.0 35.0 37.0 7 36.28975 37.0 37.0 37.0 35.0 37.0 8 36.2155 37.0 37.0 37.0 35.0 37.0 9 37.95375 39.0 38.0 39.0 35.0 39.0 10 38.082 39.0 38.0 39.0 35.0 39.0 11 38.07925 39.0 38.0 39.0 35.0 39.0 12 38.0235 39.0 39.0 39.0 35.0 39.0 13 37.93725 39.0 38.0 39.0 35.0 39.0 14 39.54725 41.0 39.0 41.0 37.0 41.0 15 39.49175 41.0 39.0 41.0 36.0 41.0 16 39.424 41.0 39.0 41.0 36.0 41.0 17 39.36675 41.0 39.0 41.0 36.0 41.0 18 39.41525 41.0 39.0 41.0 36.0 41.0 19 39.45975 41.0 39.0 41.0 36.0 41.0 20 39.429 41.0 39.0 41.0 36.0 41.0 21 39.321 41.0 39.0 41.0 36.0 41.0 22 39.36225 41.0 39.0 41.0 36.0 41.0 23 39.29 41.0 39.0 41.0 36.0 41.0 24 39.1825 41.0 39.0 41.0 36.0 41.0 25 39.32175 41.0 39.0 41.0 36.0 41.0 26 39.288 41.0 39.0 41.0 36.0 41.0 27 39.2895 41.0 39.0 41.0 36.0 41.0 28 39.16 41.0 39.0 41.0 36.0 41.0 29 39.16975 41.0 39.0 41.0 36.0 41.0 30 39.15125 41.0 39.0 41.0 36.0 41.0 31 39.1395 41.0 39.0 41.0 36.0 41.0 32 39.102 40.0 39.0 41.0 36.0 41.0 33 39.063 40.0 39.0 41.0 36.0 41.0 34 39.08 40.0 39.0 41.0 36.0 41.0 35 39.005 40.0 39.0 41.0 35.0 41.0 36 38.87 40.0 38.0 41.0 35.0 41.0 37 38.86725 40.0 38.0 41.0 35.0 41.0 38 38.79625 40.0 38.0 41.0 35.0 41.0 39 38.761 40.0 38.0 41.0 35.0 41.0 40 38.7635 40.0 38.0 41.0 35.0 41.0 41 38.76125 40.0 38.0 41.0 35.0 41.0 42 38.71225 40.0 38.0 41.0 35.0 41.0 43 38.556 40.0 38.0 41.0 34.0 41.0 44 38.49 40.0 38.0 41.0 34.0 41.0 45 38.22475 40.0 38.0 41.0 33.0 41.0 46 38.27575 40.0 38.0 41.0 33.0 41.0 47 38.31725 40.0 38.0 41.0 33.0 41.0 48 38.26825 40.0 38.0 41.0 34.0 41.0 49 38.202 40.0 38.0 41.0 33.0 41.0 50 38.094 40.0 38.0 41.0 33.0 41.0 51 37.9885 40.0 37.0 41.0 33.0 41.0 52 36.5205 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 0.0 25 2.0 26 13.0 27 12.0 28 18.0 29 24.0 30 43.0 31 48.0 32 52.0 33 84.0 34 112.0 35 150.0 36 207.0 37 363.0 38 811.0 39 2045.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.22222222222222 10.61111111111111 5.833333333333333 45.33333333333333 2 22.625 14.524999999999999 37.125 25.724999999999998 3 21.4 16.425 25.724999999999998 36.449999999999996 4 24.099999999999998 26.474999999999998 22.425 27.0 5 24.525 31.125000000000004 23.3 21.05 6 17.2 33.575 24.8 24.425 7 14.05 22.325 43.475 20.150000000000002 8 16.75 21.375 33.775 28.1 9 17.724999999999998 20.625 34.35 27.3 10 18.0 35.5 25.5 21.0 11 23.225 26.775 22.3 27.700000000000003 12 20.974999999999998 23.849999999999998 27.05 28.125 13 20.0 25.924999999999997 29.125 24.95 14 19.625 26.674999999999997 27.55 26.150000000000002 15 21.925 25.650000000000002 26.575 25.85 16 21.55 25.974999999999998 25.85 26.625 17 21.15 25.924999999999997 27.85 25.074999999999996 18 20.474999999999998 25.374999999999996 27.075 27.075 19 20.5 26.775 27.525 25.2 20 20.674999999999997 25.55 27.35 26.424999999999997 21 20.200000000000003 25.85 27.250000000000004 26.700000000000003 22 20.674999999999997 26.150000000000002 26.85 26.325 23 21.5 25.224999999999998 28.95 24.325 24 20.625 25.924999999999997 27.1 26.35 25 21.65 26.1 27.35 24.9 26 20.05 25.825 28.999999999999996 25.124999999999996 27 20.325 25.15 27.150000000000002 27.375 28 20.225 26.174999999999997 27.400000000000002 26.200000000000003 29 20.175 24.825 27.825 27.175 30 21.4 24.224999999999998 27.800000000000004 26.575 31 21.925 26.674999999999997 26.400000000000002 25.0 32 20.349999999999998 25.525 28.375 25.75 33 21.175 25.324999999999996 28.675 24.825 34 20.625 27.224999999999998 26.35 25.8 35 21.6 24.675 27.750000000000004 25.974999999999998 36 20.225 24.95 28.275 26.55 37 21.65 25.474999999999998 26.625 26.25 38 22.025 24.8 28.375 24.8 39 20.875 24.875 28.349999999999998 25.900000000000002 40 20.525 25.874999999999996 26.6 27.0 41 21.475 25.8 27.725 25.0 42 21.175 25.6 26.625 26.6 43 20.925 25.124999999999996 27.200000000000003 26.75 44 21.099999999999998 26.625 26.724999999999998 25.55 45 21.275 24.9 25.900000000000002 27.925 46 21.3 26.200000000000003 25.525 26.974999999999998 47 21.525 25.974999999999998 26.85 25.650000000000002 48 21.05 25.374999999999996 27.025 26.55 49 21.45 25.6 26.35 26.6 50 21.155288822205552 25.63140785196299 27.906976744186046 25.30632658164541 51 19.525000000000002 24.95 28.549999999999997 26.974999999999998 52 20.625 24.825 27.375 27.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 3.5 21 5.0 22 5.5 23 6.0 24 7.0 25 8.0 26 13.0 27 18.0 28 24.5 29 31.0 30 40.5 31 50.0 32 63.0 33 76.0 34 76.0 35 76.0 36 100.5 37 125.0 38 168.5 39 225.0 40 238.0 41 268.0 42 298.0 43 323.0 44 348.0 45 371.0 46 394.0 47 419.0 48 444.0 49 422.5 50 401.0 51 369.0 52 337.0 53 310.5 54 284.0 55 247.0 56 210.0 57 188.0 58 166.0 59 134.5 60 103.0 61 87.0 62 71.0 63 53.5 64 32.0 65 28.0 66 21.5 67 15.0 68 10.0 69 5.0 70 3.0 71 1.0 72 3.0 73 5.0 74 4.0 75 3.0 76 2.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 10.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21776431995963 98.3 2 0.7317688619732526 1.4500000000000002 3 0.025233409033560434 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025233409033560434 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra Read 200000 spots for SRR5423553.sra Written 200000 spots for SRR5423553.sra SRR ids: ['SRR5423553.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n1iar_ww SRR5423553.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423553 file size 703951 SRR5423553 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423553 SRR5423553_1.fastq Input file: SRR5423553_1.fastq trimmed: SRR5423553-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:41:12 2025 >> started Thu Feb 13 13:41:15 2025 >> done (2.586s) 4000000 reads processed; of these: 152 ( 0.00%) short reads filtered out after trimming by size control 262 ( 0.01%) empty reads filtered out after trimming by size control 3999586 (99.99%) reads available; of these: 56462 ( 1.41%) trimmed reads available after processing 3943124 (98.59%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 5 0.00% 21 2 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 3 0.00% 29 5 0.00% 30 11 0.00% 31 11 0.00% 32 11 0.00% 33 23 0.00% 34 24 0.00% 35 28 0.00% 36 32 0.00% 37 44 0.00% 38 43 0.00% 39 64 0.00% 40 64 0.00% 41 94 0.00% 42 95 0.00% 43 140 0.00% 44 225 0.01% 45 292 0.01% 46 434 0.01% 47 604 0.02% 48 1045 0.03% 49 2267 0.06% 50 6187 0.15% 51 44687 1.12% 52 3943124 98.59% 3999586 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.28 fanout-score-rank=26 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=211.49 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.6 sequence=CTTCTTCTTCTC Started job on | Feb 13 13:41:26 Started mapping on | Feb 13 13:41:27 Finished on | Feb 13 13:41:32 Mapping speed, Million of reads per hour | 2879.70 Number of input reads | 3999586 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3643682 Uniquely mapped reads % | 91.10% Average mapped length | 51.82 Number of splices: Total | 482926 Number of splices: Annotated (sjdb) | 475303 Number of splices: GT/AG | 476231 Number of splices: GC/AG | 5788 Number of splices: AT/AC | 329 Number of splices: Non-canonical | 578 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282910 % of reads mapped to multiple loci | 7.07% Number of reads mapped to too many loci | 43258 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72994 72994 72994 N_multimapping 282910 282910 282910 N_noFeature 127087 3611983 142793 N_ambiguous 26659 58 10631 UnstrandedReadsAssigned:3489936 PositiveStrandReadsAssigned:31641 NegativeStrandReadsAssigned:3490258 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423553 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423553-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,586 reads, 3,670,145 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR5423553.ke.tsv 34699 SRR5423553.se.tsv 87100 total ==> SRR5423553.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 200.543 33.1474 Potri.005G024800.1.v4.1 1035 936 34 11.5218 Potri.004G059700.1.v4.1 961 862 5 1.83984 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 90.1714 10.0567 Potri.016G087400.1.v4.1 270 171 184 341.303 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 12.3331 2.33686 Potri.012G127500.1.v4.1 977 878 1967 710.604 ==> SRR5423553.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 10 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR5423553 completed mapping pipeline successfully