Starting /dee2/code/volunteer_pipeline.sh SRR5423554 current disk space = 3090291617792 free memory = 1535494432 SRR5423554 SRAfilesize e71069dd642530a8d6c3642cfae82fee SRR5423554.sra SRR5423554.sra file validated SRR5423554 is single end SRR5423554 is conventional basespace SRR5423554 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423554_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.39325 34.0 31.0 34.0 30.0 34.0 2 32.48925 34.0 31.0 34.0 30.0 34.0 3 32.57275 34.0 31.0 34.0 31.0 34.0 4 35.764 37.0 35.0 37.0 33.0 37.0 5 35.94475 37.0 35.0 37.0 35.0 37.0 6 35.872 37.0 35.0 37.0 35.0 37.0 7 35.896 37.0 35.0 37.0 35.0 37.0 8 35.91075 37.0 35.0 37.0 35.0 37.0 9 37.5935 39.0 37.0 39.0 35.0 39.0 10 37.52475 39.0 37.0 39.0 34.0 39.0 11 37.66625 39.0 37.0 39.0 35.0 39.0 12 37.689 39.0 37.0 39.0 35.0 39.0 13 37.58175 39.0 37.0 39.0 35.0 39.0 14 38.857 40.0 38.0 41.0 35.0 41.0 15 38.96675 40.0 38.0 41.0 35.0 41.0 16 38.89575 40.0 38.0 41.0 35.0 41.0 17 38.79375 40.0 38.0 41.0 35.0 41.0 18 38.82775 40.0 38.0 41.0 35.0 41.0 19 38.8545 40.0 38.0 41.0 35.0 41.0 20 38.87125 40.0 38.0 41.0 34.0 41.0 21 39.007 40.0 38.0 41.0 35.0 41.0 22 38.84625 40.0 38.0 41.0 35.0 41.0 23 38.952 40.0 39.0 41.0 35.0 41.0 24 38.95 40.0 38.0 41.0 35.0 41.0 25 39.00925 40.0 38.0 41.0 35.0 41.0 26 38.83525 40.0 38.0 41.0 34.0 41.0 27 38.84175 40.0 38.0 41.0 35.0 41.0 28 38.764 40.0 38.0 41.0 35.0 41.0 29 38.72225 40.0 38.0 41.0 34.0 41.0 30 38.74375 40.0 38.0 41.0 35.0 41.0 31 38.6865 40.0 38.0 41.0 35.0 41.0 32 38.70925 40.0 38.0 41.0 35.0 41.0 33 38.5235 40.0 38.0 41.0 34.0 41.0 34 38.688 40.0 38.0 41.0 34.0 41.0 35 38.639 40.0 38.0 41.0 35.0 41.0 36 38.49775 40.0 38.0 41.0 34.0 41.0 37 38.543 40.0 38.0 41.0 34.0 41.0 38 38.5185 40.0 38.0 41.0 34.0 41.0 39 38.59225 40.0 38.0 41.0 34.0 41.0 40 38.357 40.0 38.0 41.0 34.0 41.0 41 38.145 40.0 38.0 41.0 33.0 41.0 42 38.23525 40.0 38.0 41.0 33.0 41.0 43 38.03475 40.0 38.0 41.0 33.0 41.0 44 38.11075 40.0 38.0 41.0 33.0 41.0 45 38.11225 40.0 38.0 41.0 33.0 41.0 46 37.981 40.0 37.0 41.0 33.0 41.0 47 37.846 40.0 37.0 41.0 33.0 41.0 48 37.878 40.0 37.0 41.0 33.0 41.0 49 37.8535 40.0 37.0 41.0 33.0 41.0 50 37.864 40.0 37.0 41.0 33.0 41.0 51 37.70575 40.0 37.0 41.0 32.0 41.0 52 36.769 39.0 36.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2309 1 0.0 2309 2 0.0 2309 3 0.0 2309 4 0.0 2309 5 0.0 2309 6 0.0 2309 7 0.0 2309 8 0.0 2309 9 0.0 2309 10 0.0 2309 11 0.0 2309 12 0.0 2309 13 0.0 2309 14 0.0 2309 15 0.0 2309 16 0.0 2309 17 0.0 2309 18 0.0 2309 19 0.0 2309 20 0.0 2309 21 0.0 2309 22 0.0 2309 23 0.0 2309 24 0.0 2309 25 0.0 2309 26 0.0 2309 27 0.0 2309 28 0.0 2309 29 0.0 2309 30 0.0 2309 31 0.0 2309 32 0.0 2309 33 0.0 2309 34 0.0 2309 35 0.0 2309 36 0.0 2309 37 0.0 2309 38 0.0 2309 39 0.0 2309 40 0.0 2309 41 0.0 2309 42 0.0 2309 43 0.0 2309 44 0.0 2309 45 0.0 2309 46 0.0 2309 47 0.0 2309 48 0.0 2309 49 0.0 2309 50 0.0 2309 51 0.0 2309 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 1.0 24 3.0 25 7.0 26 9.0 27 17.0 28 24.0 29 34.0 30 49.0 31 63.0 32 78.0 33 117.0 34 140.0 35 178.0 36 251.0 37 364.0 38 695.0 39 1960.0 40 7.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.46873436718359 11.13056528264132 6.228114057028514 45.17258629314657 2 22.45 15.125 38.3 24.125 3 21.349999999999998 17.65 25.825 35.175 4 24.0 26.6 22.025 27.375 5 22.825 32.125 25.374999999999996 19.675 6 19.35 31.724999999999998 25.35 23.575 7 14.499999999999998 21.975 43.974999999999994 19.55 8 16.950000000000003 22.675 32.75 27.625 9 17.125 20.375 36.125 26.375 10 17.7 35.725 26.125 20.45 11 23.625 27.425 22.15 26.8 12 23.075000000000003 22.25 26.85 27.825 13 20.775 26.575 27.575 25.074999999999996 14 20.45 27.450000000000003 27.200000000000003 24.9 15 20.9 25.2 27.3 26.6 16 21.025 25.874999999999996 27.450000000000003 25.650000000000002 17 20.7 26.900000000000002 27.375 25.025 18 19.775000000000002 27.075 26.325 26.825 19 20.200000000000003 25.275 27.775 26.75 20 20.275000000000002 26.125 27.675 25.924999999999997 21 20.599999999999998 24.95 27.200000000000003 27.250000000000004 22 21.85 25.85 27.474999999999998 24.825 23 22.0 26.075 27.3 24.625 24 21.48037009252313 25.506376594148538 26.981745436359088 26.03150787696924 25 20.775 24.925 27.200000000000003 27.1 26 19.975 26.924999999999997 27.700000000000003 25.4 27 21.05 25.6 28.225 25.124999999999996 28 20.525 25.4 27.500000000000004 26.575 29 21.2 26.025 28.225 24.55 30 21.099999999999998 25.15 26.400000000000002 27.35 31 19.55 27.275 27.224999999999998 25.95 32 20.8 27.075 27.05 25.074999999999996 33 21.4 25.174999999999997 27.075 26.35 34 22.1 25.1 26.3 26.5 35 22.5 25.95 27.575 23.974999999999998 36 20.974999999999998 25.025 26.75 27.250000000000004 37 22.575 26.025 25.25 26.150000000000002 38 20.974999999999998 26.674999999999997 26.825 25.525 39 21.7 24.349999999999998 25.974999999999998 27.975 40 21.075 25.124999999999996 27.05 26.75 41 22.650000000000002 26.075 26.224999999999998 25.05 42 21.224999999999998 25.05 27.325 26.400000000000002 43 21.425 25.0 27.35 26.224999999999998 44 22.155538884721178 25.881470367591895 27.556889222305575 24.406101525381345 45 22.15 24.45 27.150000000000002 26.25 46 21.67167167167167 25.725725725725724 27.077077077077078 25.525525525525527 47 21.46609957468101 25.66925193895422 27.52064048036027 25.344008006004504 48 21.11055527763882 25.48774387193597 26.988494247123562 26.413206603301653 49 21.180295073768445 25.681420355088775 26.25656414103526 26.881720430107524 50 20.695695695695697 26.126126126126124 27.75275275275275 25.425425425425423 51 21.65 25.0 26.650000000000002 26.700000000000003 52 22.375 26.0 25.874999999999996 25.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 3.5 21 3.0 22 4.5 23 6.0 24 9.5 25 13.0 26 15.5 27 18.0 28 18.5 29 19.0 30 36.5 31 54.0 32 55.5 33 57.0 34 83.5 35 110.0 36 133.0 37 156.0 38 173.5 39 204.5 40 218.0 41 251.5 42 285.0 43 319.5 44 354.0 45 372.5 46 391.0 47 398.0 48 405.0 49 399.5 50 394.0 51 373.5 52 353.0 53 318.0 54 283.0 55 254.0 56 225.0 57 196.0 58 167.0 59 132.0 60 97.0 61 91.0 62 85.0 63 59.5 64 33.5 65 33.0 66 28.5 67 24.0 68 15.5 69 7.0 70 6.5 71 6.0 72 5.0 73 4.0 74 3.0 75 2.0 76 1.5 77 1.0 78 1.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.025 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.025 45 0.0 46 0.1 47 0.075 48 0.05 49 0.025 50 0.1 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19273461150352 98.3 2 0.7063572149344097 1.4000000000000001 3 0.10090817356205853 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166618 spots for SRR5423554.sra Written 166618 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra Read 166605 spots for SRR5423554.sra Written 166605 spots for SRR5423554.sra SRR ids: ['SRR5423554.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dl0dytph SRR5423554.sra spots: 3332113 blocks: [[1, 166605], [166606, 333210], [333211, 499815], [499816, 666420], [666421, 833025], [833026, 999630], [999631, 1166235], [1166236, 1332840], [1332841, 1499445], [1499446, 1666050], [1666051, 1832655], [1832656, 1999260], [1999261, 2165865], [2165866, 2332470], [2332471, 2499075], [2499076, 2665680], [2665681, 2832285], [2832286, 2998890], [2998891, 3165495], [3165496, 3332113]] SRR5423554 file size 586258 SRR5423554 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423554 SRR5423554_1.fastq Input file: SRR5423554_1.fastq trimmed: SRR5423554-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 13:53:16 2025 >> started Thu Feb 13 13:53:18 2025 >> done (1.732s) 3332113 reads processed; of these: 146 ( 0.00%) short reads filtered out after trimming by size control 248 ( 0.01%) empty reads filtered out after trimming by size control 3331719 (99.99%) reads available; of these: 37848 ( 1.14%) trimmed reads available after processing 3293871 (98.86%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 6 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 2 0.00% 25 4 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 1 0.00% 30 1 0.00% 31 3 0.00% 32 4 0.00% 33 11 0.00% 34 9 0.00% 35 14 0.00% 36 11 0.00% 37 13 0.00% 38 20 0.00% 39 23 0.00% 40 22 0.00% 41 47 0.00% 42 55 0.00% 43 76 0.00% 44 97 0.00% 45 127 0.00% 46 196 0.01% 47 355 0.01% 48 582 0.02% 49 1284 0.04% 50 4266 0.13% 51 30603 0.92% 52 3293871 98.86% 3331719 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=8 prefix-density=0.42 prefix-fanout=1.6 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=15 fanout-score=188.03 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=23.0 sequence=CTTCTTCTTCTT Started job on | Feb 13 13:53:31 Started mapping on | Feb 13 13:53:31 Finished on | Feb 13 13:53:35 Mapping speed, Million of reads per hour | 2998.55 Number of input reads | 3331719 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3036889 Uniquely mapped reads % | 91.15% Average mapped length | 51.82 Number of splices: Total | 401698 Number of splices: Annotated (sjdb) | 395264 Number of splices: GT/AG | 396109 Number of splices: GC/AG | 4865 Number of splices: AT/AC | 258 Number of splices: Non-canonical | 466 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 233993 % of reads mapped to multiple loci | 7.02% Number of reads mapped to too many loci | 36537 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 60837 60837 60837 N_multimapping 233993 233993 233993 N_noFeature 106701 3010299 119727 N_ambiguous 22538 52 8956 UnstrandedReadsAssigned:2907650 PositiveStrandReadsAssigned:26538 NegativeStrandReadsAssigned:2908206 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423554 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423554-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,331,719 reads, 3,054,313 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,196 rounds 52401 SRR5423554.ke.tsv 34699 SRR5423554.se.tsv 87100 total ==> SRR5423554.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 165 32.7846 Potri.005G024800.1.v4.1 1035 936 25 10.1842 Potri.004G059700.1.v4.1 961 862 3 1.32701 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 56.0994 7.52124 Potri.016G087400.1.v4.1 270 171 146.698 327.107 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 9.85062 2.24373 Potri.012G127500.1.v4.1 977 878 1600 694.843 ==> SRR5423554.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 67 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR5423554 completed mapping pipeline successfully