Starting /dee2/code/volunteer_pipeline.sh SRR5423555 current disk space = 3089568976896 free memory = 1582663148 SRR5423555 SRAfilesize 3a3a8a3bf92301c3ebef3b0077ac348e SRR5423555.sra SRR5423555.sra file validated SRR5423555 is single end SRR5423555 is conventional basespace SRR5423555 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423555_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.11525 33.0 32.0 34.0 2.0 34.0 2 31.5995 33.0 31.0 34.0 27.0 34.0 3 31.767 33.0 32.0 34.0 27.0 34.0 4 31.37375 33.0 32.0 34.0 27.0 34.0 5 32.09675 33.0 32.0 34.0 30.0 34.0 6 35.46425 38.0 36.0 38.0 29.0 38.0 7 35.8305 38.0 36.0 38.0 31.0 38.0 8 36.0425 38.0 37.0 38.0 31.0 38.0 9 36.03775 38.0 37.0 38.0 33.0 38.0 10 36.204 38.0 37.0 38.0 33.0 38.0 11 36.29375 38.0 37.0 38.0 33.0 38.0 12 36.20325 38.0 37.0 38.0 33.0 38.0 13 35.97 38.0 37.0 38.0 31.0 38.0 14 36.03125 38.0 37.0 38.0 31.0 38.0 15 35.7545 38.0 37.0 38.0 31.0 38.0 16 36.07975 38.0 37.0 38.0 31.0 38.0 17 36.31575 38.0 37.0 38.0 33.0 38.0 18 35.729 38.0 37.0 38.0 29.0 38.0 19 35.908 38.0 37.0 38.0 31.0 38.0 20 36.30975 38.0 37.0 38.0 33.0 38.0 21 36.39325 38.0 37.0 38.0 33.0 38.0 22 36.4355 38.0 37.0 38.0 33.0 38.0 23 36.18425 38.0 37.0 38.0 33.0 38.0 24 36.35725 38.0 37.0 38.0 33.0 38.0 25 36.314 38.0 37.0 38.0 33.0 38.0 26 36.35975 38.0 37.0 38.0 34.0 38.0 27 36.124 38.0 37.0 38.0 33.0 38.0 28 36.22975 38.0 37.0 38.0 33.0 38.0 29 36.545 38.0 38.0 38.0 34.0 38.0 30 36.36475 38.0 38.0 38.0 34.0 38.0 31 36.53375 38.0 38.0 38.0 34.0 38.0 32 36.56275 38.0 38.0 38.0 34.0 38.0 33 36.3105 38.0 37.0 38.0 33.0 38.0 34 36.38475 38.0 38.0 38.0 33.0 38.0 35 36.26325 38.0 37.0 38.0 33.0 38.0 36 36.26525 38.0 37.0 38.0 33.0 38.0 37 36.3415 38.0 37.0 38.0 33.0 38.0 38 36.50575 38.0 38.0 38.0 34.0 38.0 39 36.4835 38.0 37.0 38.0 34.0 38.0 40 36.3905 38.0 38.0 38.0 34.0 38.0 41 36.38 38.0 38.0 38.0 34.0 38.0 42 36.3185 38.0 37.0 38.0 33.0 38.0 43 36.44775 38.0 38.0 38.0 34.0 38.0 44 36.61425 38.0 38.0 38.0 34.0 38.0 45 36.351 38.0 38.0 38.0 33.0 38.0 46 36.47575 38.0 38.0 38.0 34.0 38.0 47 36.4425 38.0 38.0 38.0 34.0 38.0 48 36.443 38.0 38.0 38.0 34.0 38.0 49 36.451 38.0 38.0 38.0 34.0 38.0 50 36.3605 38.0 38.0 38.0 33.0 38.0 51 36.31375 38.0 37.0 38.0 33.0 38.0 52 36.10875 38.0 37.0 38.0 32.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 4.0 24 7.0 25 15.0 26 14.0 27 18.0 28 41.0 29 53.0 30 93.0 31 102.0 32 135.0 33 200.0 34 286.0 35 445.0 36 959.0 37 1628.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.762850467289724 11.886682242990654 7.155373831775701 43.195093457943926 2 22.400000000000002 15.174999999999999 37.05 25.374999999999996 3 20.549999999999997 19.45 25.474999999999998 34.525 4 24.075 27.125 22.2 26.6 5 23.275000000000002 31.275 23.3 22.15 6 19.7 33.050000000000004 23.400000000000002 23.849999999999998 7 13.875000000000002 23.925 42.95 19.25 8 17.349999999999998 21.375 32.225 29.049999999999997 9 17.549999999999997 20.9 33.900000000000006 27.650000000000002 10 17.05 36.425000000000004 25.25 21.275 11 22.75 27.725 22.35 27.175 12 20.45 22.6 28.325 28.625 13 19.575 26.125 28.599999999999998 25.7 14 19.975 27.0 28.525 24.5 15 21.075 23.875 28.249999999999996 26.8 16 20.75 26.325 26.85 26.075 17 20.825 26.825 26.650000000000002 25.7 18 20.575 26.375 28.1 24.95 19 20.05 26.974999999999998 28.15 24.825 20 21.2 26.450000000000003 27.625 24.725 21 19.775000000000002 26.424999999999997 26.950000000000003 26.85 22 21.05 27.725 27.400000000000002 23.825 23 21.3 26.35 27.0 25.35 24 20.4 26.55 25.900000000000002 27.150000000000002 25 20.349999999999998 26.224999999999998 26.924999999999997 26.5 26 19.425 26.224999999999998 27.700000000000003 26.650000000000002 27 21.45 26.35 26.35 25.85 28 20.7 27.625 26.450000000000003 25.224999999999998 29 19.7 26.0 28.749999999999996 25.55 30 20.8 24.825 26.974999999999998 27.400000000000002 31 20.1 27.325 25.75 26.825 32 19.650000000000002 27.450000000000003 27.925 24.975 33 20.525 25.0 27.900000000000002 26.575 34 20.8 25.624999999999996 26.775 26.8 35 21.4 25.8 27.0 25.8 36 20.65 25.275 26.8 27.275 37 21.15 26.200000000000003 25.974999999999998 26.674999999999997 38 21.175 25.624999999999996 27.075 26.125 39 20.275000000000002 25.724999999999998 26.55 27.450000000000003 40 19.8 26.575 27.35 26.275 41 22.325 24.675 28.000000000000004 25.0 42 21.125 24.975 28.1 25.8 43 21.25 25.8 25.900000000000002 27.05 44 21.099999999999998 26.05 26.900000000000002 25.95 45 20.275000000000002 24.025 27.200000000000003 28.499999999999996 46 20.125 26.325 25.974999999999998 27.575 47 21.425 26.450000000000003 26.075 26.05 48 21.55 24.325 27.675 26.450000000000003 49 20.925 26.55 26.650000000000002 25.874999999999996 50 21.875 24.95 27.525 25.650000000000002 51 21.125 24.175 27.025 27.675 52 20.555138784696176 26.131532883220803 25.95648912228057 27.35683920980245 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.5 19 2.0 20 2.5 21 3.0 22 3.5 23 4.0 24 7.5 25 11.0 26 15.0 27 19.0 28 25.0 29 31.0 30 43.0 31 55.0 32 68.5 33 82.0 34 99.5 35 117.0 36 136.0 37 155.0 38 182.0 39 235.5 40 262.0 41 275.5 42 289.0 43 312.0 44 335.0 45 357.5 46 380.0 47 382.0 48 384.0 49 385.0 50 386.0 51 367.0 52 348.0 53 309.0 54 270.0 55 250.5 56 231.0 57 191.5 58 152.0 59 129.0 60 106.0 61 83.5 62 61.0 63 50.5 64 32.0 65 24.0 66 21.0 67 18.0 68 11.5 69 5.0 70 5.5 71 6.0 72 7.0 73 8.0 74 5.5 75 3.0 76 2.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 14.399999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.25119316754584275 0.5 3 0.07535795026375283 0.22499999999999998 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464604 spots for SRR5423555.sra Written 1464604 spots for SRR5423555.sra Read 1464608 spots for SRR5423555.sra Written 1464608 spots for SRR5423555.sra SRR ids: ['SRR5423555.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x7dzpdow SRR5423555.sra spots: 29292084 blocks: [[1, 1464604], [1464605, 2929208], [2929209, 4393812], [4393813, 5858416], [5858417, 7323020], [7323021, 8787624], [8787625, 10252228], [10252229, 11716832], [11716833, 13181436], [13181437, 14646040], [14646041, 16110644], [16110645, 17575248], [17575249, 19039852], [19039853, 20504456], [20504457, 21969060], [21969061, 23433664], [23433665, 24898268], [24898269, 26362872], [26362873, 27827476], [27827477, 29292084]] SRR5423555 file size 5094975 SRR5423555 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423555 SRR5423555_1.fastq Input file: SRR5423555_1.fastq trimmed: SRR5423555-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:33:40 2025 >> started Thu Feb 13 14:33:57 2025 >> done (17.128s) 29292084 reads processed; of these: 1527 ( 0.01%) short reads filtered out after trimming by size control 2409 ( 0.01%) empty reads filtered out after trimming by size control 29288148 (99.99%) reads available; of these: 2210 ( 0.01%) trimmed reads available after processing 29285938 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 42 0.00% 19 43 0.00% 20 33 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 2092 0.01% 52 29285938 99.99% 29288148 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=27 prefix-density=0.14 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=188.24 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=22.6 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:34:10 Started mapping on | Feb 13 14:34:10 Finished on | Feb 13 14:34:42 Mapping speed, Million of reads per hour | 3294.92 Number of input reads | 29288148 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 26643833 Uniquely mapped reads % | 90.97% Average mapped length | 51.82 Number of splices: Total | 3548458 Number of splices: Annotated (sjdb) | 3493256 Number of splices: GT/AG | 3500593 Number of splices: GC/AG | 41725 Number of splices: AT/AC | 2590 Number of splices: Non-canonical | 3550 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.61 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2038098 % of reads mapped to multiple loci | 6.96% Number of reads mapped to too many loci | 332504 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.93% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 606217 606217 606217 N_multimapping 2038098 2038098 2038098 N_noFeature 939534 26420178 1044030 N_ambiguous 197205 438 77877 UnstrandedReadsAssigned:25507094 PositiveStrandReadsAssigned:223217 NegativeStrandReadsAssigned:25521926 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423555 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423555-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,288,148 reads, 25,880,458 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,323 rounds 52401 SRR5423555.ke.tsv 34699 SRR5423555.se.tsv 87100 total ==> SRR5423555.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1251.48 29.3516 Potri.005G024800.1.v4.1 1035 936 230.144 11.0663 Potri.004G059700.1.v4.1 961 862 54.3343 2.83693 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 517.091 8.18311 Potri.016G087400.1.v4.1 270 171 1334.5 351.239 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 90.3187 2.42831 Potri.012G127500.1.v4.1 977 878 14420 739.183 ==> SRR5423555.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 88 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 735 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 165 SRR5423555 completed mapping pipeline successfully