Starting /dee2/code/volunteer_pipeline.sh SRR5423556 current disk space = 3090085601280 free memory = 1475923128 SRR5423556 SRAfilesize bf3d34165f3009fe7d95d44eaccb448a SRR5423556.sra SRR5423556.sra file validated SRR5423556 is single end SRR5423556 is conventional basespace SRR5423556 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423556_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.143 33.0 31.0 34.0 30.0 34.0 2 32.194 34.0 31.0 34.0 30.0 34.0 3 32.411 34.0 31.0 34.0 30.0 34.0 4 35.2795 37.0 35.0 37.0 32.0 37.0 5 35.62125 37.0 35.0 37.0 33.0 37.0 6 35.81675 37.0 35.0 37.0 35.0 37.0 7 35.7855 37.0 35.0 37.0 35.0 37.0 8 35.904 37.0 35.0 37.0 35.0 37.0 9 37.6765 39.0 37.0 39.0 35.0 39.0 10 37.476 39.0 37.0 39.0 35.0 39.0 11 37.52625 39.0 37.0 39.0 35.0 39.0 12 37.607 39.0 37.0 39.0 35.0 39.0 13 37.5525 39.0 37.0 39.0 35.0 39.0 14 38.877 40.0 38.0 41.0 35.0 41.0 15 38.98 40.0 38.0 41.0 36.0 41.0 16 38.85525 40.0 38.0 41.0 35.0 41.0 17 38.701 40.0 38.0 41.0 35.0 41.0 18 38.7245 40.0 38.0 41.0 34.0 41.0 19 38.75275 40.0 38.0 41.0 34.0 41.0 20 38.80825 40.0 38.0 41.0 34.0 41.0 21 38.76725 40.0 38.0 41.0 34.0 41.0 22 38.67775 40.0 38.0 41.0 34.0 41.0 23 38.80975 40.0 38.0 41.0 34.0 41.0 24 38.8645 40.0 38.0 41.0 35.0 41.0 25 38.87975 40.0 38.0 41.0 35.0 41.0 26 38.83175 40.0 38.0 41.0 35.0 41.0 27 38.82925 40.0 38.0 41.0 35.0 41.0 28 38.75425 40.0 38.0 41.0 35.0 41.0 29 38.7855 40.0 38.0 41.0 35.0 41.0 30 38.51175 40.0 38.0 41.0 34.0 41.0 31 38.79225 40.0 38.0 41.0 35.0 41.0 32 38.704 40.0 38.0 41.0 34.0 41.0 33 38.629 40.0 38.0 41.0 34.0 41.0 34 38.572 40.0 38.0 41.0 34.0 41.0 35 38.4695 40.0 38.0 41.0 34.0 41.0 36 38.618 40.0 38.0 41.0 35.0 41.0 37 38.52575 40.0 38.0 41.0 34.0 41.0 38 38.4105 40.0 38.0 41.0 34.0 41.0 39 38.20525 40.0 38.0 41.0 33.0 41.0 40 38.28475 40.0 38.0 41.0 34.0 41.0 41 38.16775 40.0 38.0 41.0 33.0 41.0 42 38.0075 40.0 38.0 41.0 33.0 41.0 43 38.193 40.0 38.0 41.0 33.0 41.0 44 38.125 40.0 38.0 41.0 33.0 41.0 45 38.03325 40.0 37.0 41.0 33.0 41.0 46 37.91975 40.0 37.0 41.0 33.0 41.0 47 38.04725 40.0 37.0 41.0 33.0 41.0 48 37.7905 40.0 37.0 41.0 33.0 41.0 49 37.68275 40.0 37.0 41.0 33.0 41.0 50 37.433 40.0 37.0 41.0 31.0 41.0 51 37.61875 40.0 37.0 41.0 32.0 41.0 52 37.0225 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1111 1 0.0 1111 2 0.0 1111 3 0.0 1111 4 0.0 1111 5 0.0 1111 6 0.0 1111 7 0.0 1111 8 0.0 1111 9 0.0 1111 10 0.0 1111 11 0.0 1111 12 0.0 1111 13 0.0 1111 14 0.0 1111 15 0.0 1111 16 0.0 1111 17 0.0 1111 18 0.0 1111 19 0.0 1111 20 0.0 1111 21 0.0 1111 22 0.0 1111 23 0.0 1111 24 0.0 1111 25 0.0 1111 26 0.0 1111 27 0.0 1111 28 0.0 1111 29 0.0 1111 30 0.0 1111 31 0.0 1111 32 0.0 1111 33 0.0 1111 34 0.0 1111 35 0.0 1111 36 0.0 1111 37 0.0 1111 38 0.0 1111 39 0.0 1111 40 0.0 1111 41 0.0 1111 42 0.0 1111 43 0.0 1111 44 0.0 1111 45 0.0 1111 46 0.0 1111 47 0.0 1111 48 0.0 1111 49 0.0 1111 50 0.0 1111 51 0.0 1111 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 6.0 24 8.0 25 4.0 26 5.0 27 23.0 28 22.0 29 31.0 30 44.0 31 71.0 32 87.0 33 101.0 34 158.0 35 191.0 36 272.0 37 389.0 38 730.0 39 1851.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.785016286644954 11.926835379604109 6.439488849912303 43.84865948383864 2 21.4 14.725 38.25 25.624999999999996 3 21.525 18.125 24.725 35.625 4 24.625 25.6 23.0 26.775 5 23.200000000000003 32.75 23.400000000000002 20.65 6 19.5 32.125 25.575 22.8 7 12.775 23.25 43.1 20.875 8 17.375 21.3 33.7 27.625 9 17.724999999999998 21.099999999999998 35.35 25.825 10 19.375 35.3 24.0 21.325 11 21.85 27.075 22.825 28.249999999999996 12 22.075 22.975 27.224999999999998 27.725 13 18.725 26.474999999999998 28.875 25.924999999999997 14 19.775000000000002 26.974999999999998 28.749999999999996 24.5 15 19.525000000000002 24.575 27.825 28.075 16 20.325 26.8 27.700000000000003 25.174999999999997 17 22.425 25.85 25.624999999999996 26.1 18 20.5 26.174999999999997 27.275 26.05 19 21.55 26.025 26.05 26.375 20 20.974999999999998 26.700000000000003 27.275 25.05 21 20.549999999999997 26.200000000000003 26.700000000000003 26.55 22 20.025000000000002 27.525 27.224999999999998 25.224999999999998 23 20.875 26.55 27.150000000000002 25.424999999999997 24 22.425 24.5 26.75 26.325 25 19.325 25.775 27.950000000000003 26.950000000000003 26 20.974999999999998 26.3 28.025 24.7 27 20.474999999999998 25.45 28.199999999999996 25.874999999999996 28 20.225 26.400000000000002 27.800000000000004 25.575 29 20.825 26.224999999999998 27.474999999999998 25.474999999999998 30 21.425 27.3 26.85 24.425 31 21.025 26.3 24.975 27.700000000000003 32 20.825 26.474999999999998 26.85 25.85 33 20.474999999999998 24.975 28.549999999999997 26.0 34 21.525 25.650000000000002 25.4 27.425 35 20.75 25.874999999999996 26.85 26.525 36 21.025 25.575 26.55 26.85 37 21.675 25.8 27.05 25.474999999999998 38 21.125 26.974999999999998 27.775 24.125 39 20.7 25.2 26.1 28.000000000000004 40 20.724999999999998 26.55 26.1 26.625 41 21.925 25.874999999999996 26.700000000000003 25.5 42 20.674999999999997 25.324999999999996 27.55 26.450000000000003 43 20.5 25.8 26.275 27.425 44 21.025 25.900000000000002 27.375 25.7 45 20.549999999999997 25.474999999999998 26.05 27.925 46 20.849999999999998 25.874999999999996 26.200000000000003 27.075 47 21.45 26.35 25.724999999999998 26.474999999999998 48 21.224999999999998 23.875 27.35 27.55 49 20.125 26.775 25.674999999999997 27.425 50 21.675 25.6 26.075 26.650000000000002 51 20.375 24.975 27.875 26.775 52 22.0 25.674999999999997 25.85 26.474999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 2.0 18 2.5 19 3.0 20 4.0 21 5.0 22 6.5 23 8.0 24 8.5 25 9.0 26 15.0 27 21.0 28 29.0 29 37.0 30 41.5 31 46.0 32 59.5 33 73.0 34 83.0 35 93.0 36 124.5 37 156.0 38 172.0 39 204.0 40 220.0 41 263.0 42 306.0 43 328.0 44 350.0 45 352.0 46 354.0 47 359.5 48 365.0 49 390.5 50 416.0 51 391.0 52 366.0 53 323.0 54 280.0 55 256.5 56 233.0 57 197.0 58 161.0 59 127.5 60 94.0 61 85.0 62 76.0 63 63.5 64 40.0 65 29.0 66 25.0 67 21.0 68 16.5 69 12.0 70 10.5 71 9.0 72 10.0 73 11.0 74 6.0 75 1.0 76 1.5 77 2.0 78 1.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.605296343001261 1.2 3 0.05044136191677175 0.15 4 0.025220680958385876 0.1 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra Read 200000 spots for SRR5423556.sra Written 200000 spots for SRR5423556.sra SRR ids: ['SRR5423556.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_go8wac7r SRR5423556.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423556 file size 704008 SRR5423556 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423556 SRR5423556_1.fastq Input file: SRR5423556_1.fastq trimmed: SRR5423556-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:02:02 2025 >> started Thu Feb 13 14:02:04 2025 >> done (1.869s) 4000000 reads processed; of these: 200 ( 0.01%) short reads filtered out after trimming by size control 323 ( 0.01%) empty reads filtered out after trimming by size control 3999477 (99.99%) reads available; of these: 54853 ( 1.37%) trimmed reads available after processing 3944624 (98.63%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 6 0.00% 20 9 0.00% 21 1 0.00% 22 0 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 2 0.00% 27 5 0.00% 28 3 0.00% 29 9 0.00% 30 8 0.00% 31 9 0.00% 32 11 0.00% 33 16 0.00% 34 17 0.00% 35 15 0.00% 36 16 0.00% 37 34 0.00% 38 37 0.00% 39 53 0.00% 40 57 0.00% 41 54 0.00% 42 84 0.00% 43 126 0.00% 44 150 0.00% 45 207 0.01% 46 347 0.01% 47 509 0.01% 48 964 0.02% 49 2064 0.05% 50 6066 0.15% 51 43960 1.10% 52 3944624 98.63% 3999477 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=213.48 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=23.1 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:02:17 Started mapping on | Feb 13 14:02:17 Finished on | Feb 13 14:02:22 Mapping speed, Million of reads per hour | 2879.62 Number of input reads | 3999477 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3643953 Uniquely mapped reads % | 91.11% Average mapped length | 51.82 Number of splices: Total | 482387 Number of splices: Annotated (sjdb) | 474628 Number of splices: GT/AG | 475913 Number of splices: GC/AG | 5580 Number of splices: AT/AC | 348 Number of splices: Non-canonical | 546 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.43 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281539 % of reads mapped to multiple loci | 7.04% Number of reads mapped to too many loci | 44209 % of reads mapped to too many loci | 1.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73985 73985 73985 N_multimapping 281539 281539 281539 N_noFeature 127137 3612323 142604 N_ambiguous 26954 72 10759 UnstrandedReadsAssigned:3489862 PositiveStrandReadsAssigned:31558 NegativeStrandReadsAssigned:3490590 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423556 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423556-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,477 reads, 3,667,450 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,164 rounds 52401 SRR5423556.ke.tsv 34699 SRR5423556.se.tsv 87100 total ==> SRR5423556.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 153 25.3336 Potri.005G024800.1.v4.1 1035 936 34 11.5421 Potri.004G059700.1.v4.1 961 862 9 3.31754 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 79.2849 8.85813 Potri.016G087400.1.v4.1 270 171 179 332.612 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.4206 3.68628 Potri.012G127500.1.v4.1 977 878 2029 734.292 ==> SRR5423556.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 21 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR5423556 completed mapping pipeline successfully