Starting /dee2/code/volunteer_pipeline.sh SRR5423557 current disk space = 3090081185792 free memory = 1447101604 SRR5423557 SRAfilesize ebd9e0aa6cf4767b91f451f1c4247d8a SRR5423557.sra SRR5423557.sra file validated SRR5423557 is single end SRR5423557 is conventional basespace SRR5423557 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423557_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58125 34.0 31.0 34.0 31.0 34.0 2 32.69575 34.0 31.0 34.0 31.0 34.0 3 32.82575 34.0 31.0 34.0 31.0 34.0 4 36.25425 37.0 37.0 37.0 35.0 37.0 5 36.09 37.0 37.0 37.0 35.0 37.0 6 36.1645 37.0 36.0 37.0 35.0 37.0 7 36.1975 37.0 36.0 37.0 35.0 37.0 8 36.17775 37.0 37.0 37.0 35.0 37.0 9 38.01275 39.0 38.0 39.0 35.0 39.0 10 37.911 39.0 38.0 39.0 35.0 39.0 11 37.924 39.0 38.0 39.0 35.0 39.0 12 37.8885 39.0 38.0 39.0 35.0 39.0 13 37.82625 39.0 38.0 39.0 35.0 39.0 14 39.3715 41.0 39.0 41.0 36.0 41.0 15 39.384 41.0 39.0 41.0 36.0 41.0 16 39.3635 41.0 39.0 41.0 36.0 41.0 17 39.2775 41.0 39.0 41.0 36.0 41.0 18 39.30425 41.0 39.0 41.0 36.0 41.0 19 39.2465 40.0 39.0 41.0 36.0 41.0 20 39.268 40.0 39.0 41.0 36.0 41.0 21 39.26625 40.0 39.0 41.0 36.0 41.0 22 39.23325 40.0 39.0 41.0 36.0 41.0 23 39.21725 40.0 39.0 41.0 36.0 41.0 24 39.21375 41.0 39.0 41.0 36.0 41.0 25 39.1925 41.0 39.0 41.0 36.0 41.0 26 38.99825 40.0 39.0 41.0 36.0 41.0 27 39.096 40.0 39.0 41.0 36.0 41.0 28 39.00625 40.0 39.0 41.0 36.0 41.0 29 38.9765 40.0 39.0 41.0 35.0 41.0 30 39.0485 40.0 39.0 41.0 36.0 41.0 31 38.90925 40.0 39.0 41.0 35.0 41.0 32 38.9345 40.0 39.0 41.0 35.0 41.0 33 38.745 40.0 38.0 41.0 35.0 41.0 34 38.87125 40.0 38.0 41.0 35.0 41.0 35 38.8745 40.0 38.0 41.0 35.0 41.0 36 38.89175 40.0 38.0 41.0 35.0 41.0 37 38.6095 40.0 38.0 41.0 35.0 41.0 38 38.66425 40.0 38.0 41.0 35.0 41.0 39 38.789 40.0 38.0 41.0 35.0 41.0 40 38.70775 40.0 38.0 41.0 35.0 41.0 41 38.60575 40.0 38.0 41.0 34.0 41.0 42 38.48825 40.0 38.0 41.0 34.0 41.0 43 38.47475 40.0 38.0 41.0 34.0 41.0 44 38.3965 40.0 38.0 41.0 34.0 41.0 45 38.32825 40.0 38.0 41.0 34.0 41.0 46 38.181 40.0 38.0 41.0 33.0 41.0 47 38.16075 40.0 38.0 41.0 33.0 41.0 48 38.1865 40.0 38.0 41.0 33.0 41.0 49 38.07175 40.0 38.0 41.0 33.0 41.0 50 37.81125 40.0 37.0 41.0 33.0 41.0 51 37.78625 40.0 37.0 41.0 33.0 41.0 52 36.931 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1205 1 0.0 1205 2 0.0 1205 3 0.0 1205 4 0.0 1205 5 0.0 1205 6 0.0 1205 7 0.0 1205 8 0.0 1205 9 0.0 1205 10 0.0 1205 11 0.0 1205 12 0.0 1205 13 0.0 1205 14 0.0 1205 15 0.0 1205 16 0.0 1205 17 0.0 1205 18 0.0 1205 19 0.0 1205 20 0.0 1205 21 0.0 1205 22 0.0 1205 23 0.0 1205 24 0.0 1205 25 0.0 1205 26 0.0 1205 27 0.0 1205 28 0.0 1205 29 0.0 1205 30 0.0 1205 31 0.0 1205 32 0.0 1205 33 0.0 1205 34 0.0 1205 35 0.0 1205 36 0.0 1205 37 0.0 1205 38 0.0 1205 39 0.0 1205 40 0.0 1205 41 0.0 1205 42 0.0 1205 43 0.0 1205 44 0.0 1205 45 0.0 1205 46 0.0 1205 47 0.0 1205 48 0.0 1205 49 0.0 1205 50 0.0 1205 51 0.0 1205 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 2.0 23 2.0 24 2.0 25 6.0 26 7.0 27 16.0 28 22.0 29 30.0 30 36.0 31 41.0 32 60.0 33 84.0 34 107.0 35 149.0 36 204.0 37 375.0 38 706.0 39 2136.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.34335839598997 12.080200501253133 6.466165413533835 44.11027568922306 2 22.35 14.725 36.825 26.1 3 20.375 18.7 24.55 36.375 4 23.025000000000002 27.525 23.175 26.275 5 25.0 30.475 23.35 21.175 6 18.425 32.475 25.1 24.0 7 14.000000000000002 22.875 43.9 19.225 8 16.875 22.0 32.725 28.4 9 16.75 20.349999999999998 34.525 28.375 10 18.15 36.5 24.375 20.974999999999998 11 23.200000000000003 28.175 21.45 27.175 12 21.349999999999998 23.45 27.025 28.175 13 18.525 27.800000000000004 28.575 25.1 14 20.200000000000003 25.45 27.800000000000004 26.55 15 19.55 25.174999999999997 27.250000000000004 28.025 16 20.575 27.950000000000003 25.5 25.974999999999998 17 20.95 25.424999999999997 27.925 25.7 18 20.875 25.25 26.200000000000003 27.675 19 20.225 26.55 25.900000000000002 27.325 20 21.25 26.625 25.650000000000002 26.474999999999998 21 19.7 26.55 26.950000000000003 26.8 22 20.68017004251063 25.85646411602901 27.35683920980245 26.106526631657918 23 20.775 25.775 27.175 26.275 24 20.225 26.5 26.1 27.175 25 22.075 25.650000000000002 26.25 26.025 26 21.025 25.224999999999998 26.650000000000002 27.1 27 20.5 25.75 27.1 26.650000000000002 28 21.75 25.924999999999997 27.275 25.05 29 18.675 25.974999999999998 29.099999999999998 26.25 30 21.0 25.924999999999997 27.0 26.075 31 21.349999999999998 26.075 27.35 25.224999999999998 32 21.325 24.675 27.450000000000003 26.55 33 21.349999999999998 24.95 27.175 26.525 34 20.775 26.400000000000002 25.900000000000002 26.924999999999997 35 21.725 25.7 26.974999999999998 25.6 36 22.3 25.85 26.05 25.8 37 20.95 26.625 25.374999999999996 27.05 38 21.175 26.1 27.750000000000004 24.975 39 21.125 26.1 26.450000000000003 26.325 40 21.6 24.825 25.424999999999997 28.15 41 21.224999999999998 26.275 27.05 25.45 42 21.075 25.2 27.125 26.6 43 20.95 26.450000000000003 25.15 27.450000000000003 44 20.674999999999997 26.275 26.875 26.174999999999997 45 20.705176294073517 23.280820205051263 27.7569392348087 28.257064266066518 46 21.025 25.15 27.400000000000002 26.424999999999997 47 21.75 26.35 26.625 25.275 48 21.75543885971493 24.93123280820205 27.506876719179797 25.806451612903224 49 21.330332583145786 25.481370342585645 26.581645411352838 26.60665166291573 50 21.224999999999998 25.674999999999997 27.0 26.1 51 20.4801200300075 25.006251562890725 27.581895473868467 26.93173293323331 52 22.20555138784696 24.656164041010253 26.25656414103526 26.881720430107524 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 2.0 13 1.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 3.5 21 5.0 22 5.0 23 5.0 24 6.0 25 7.0 26 15.0 27 23.0 28 28.0 29 33.0 30 36.0 31 39.0 32 51.5 33 64.0 34 75.5 35 87.0 36 117.0 37 147.0 38 183.5 39 206.0 40 192.0 41 237.5 42 283.0 43 309.5 44 336.0 45 354.5 46 373.0 47 386.5 48 400.0 49 411.0 50 422.0 51 391.0 52 360.0 53 323.5 54 287.0 55 259.5 56 232.0 57 196.5 58 161.0 59 137.5 60 114.0 61 89.5 62 65.0 63 52.5 64 38.5 65 37.0 66 23.5 67 10.0 68 18.0 69 26.0 70 19.0 71 12.0 72 9.0 73 6.0 74 4.0 75 2.0 76 3.0 77 4.0 78 2.5 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.025 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.0 47 0.0 48 0.025 49 0.025 50 0.0 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.5285678328718851 1.05 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.025169896803423106 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra Read 200000 spots for SRR5423557.sra Written 200000 spots for SRR5423557.sra SRR ids: ['SRR5423557.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hmxmjbo7 SRR5423557.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423557 file size 703967 SRR5423557 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423557 SRR5423557_1.fastq Input file: SRR5423557_1.fastq trimmed: SRR5423557-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:05:20 2025 >> started Thu Feb 13 14:05:22 2025 >> done (1.839s) 4000000 reads processed; of these: 185 ( 0.00%) short reads filtered out after trimming by size control 277 ( 0.01%) empty reads filtered out after trimming by size control 3999538 (99.99%) reads available; of these: 50719 ( 1.27%) trimmed reads available after processing 3948819 (98.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 6 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 2 0.00% 25 1 0.00% 26 2 0.00% 27 5 0.00% 28 1 0.00% 29 2 0.00% 30 6 0.00% 31 6 0.00% 32 9 0.00% 33 17 0.00% 34 25 0.00% 35 25 0.00% 36 20 0.00% 37 36 0.00% 38 35 0.00% 39 45 0.00% 40 68 0.00% 41 53 0.00% 42 72 0.00% 43 100 0.00% 44 149 0.00% 45 216 0.01% 46 312 0.01% 47 585 0.01% 48 865 0.02% 49 1909 0.05% 50 5698 0.14% 51 40433 1.01% 52 3948819 98.73% 3999538 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=5.75 fanout-score-rank=14 prefix-density=0.42 prefix-fanout=1.6 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=23 fanout-score=190.18 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.6 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:05:32 Started mapping on | Feb 13 14:05:33 Finished on | Feb 13 14:05:37 Mapping speed, Million of reads per hour | 3599.58 Number of input reads | 3999538 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3645260 Uniquely mapped reads % | 91.14% Average mapped length | 51.83 Number of splices: Total | 482577 Number of splices: Annotated (sjdb) | 474670 Number of splices: GT/AG | 476060 Number of splices: GC/AG | 5625 Number of splices: AT/AC | 335 Number of splices: Non-canonical | 557 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281216 % of reads mapped to multiple loci | 7.03% Number of reads mapped to too many loci | 43681 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73062 73062 73062 N_multimapping 281216 281216 281216 N_noFeature 126975 3613772 142663 N_ambiguous 26696 63 10870 UnstrandedReadsAssigned:3491589 PositiveStrandReadsAssigned:31425 NegativeStrandReadsAssigned:3491727 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423557 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423557-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,538 reads, 3,670,960 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR5423557.ke.tsv 34699 SRR5423557.se.tsv 87100 total ==> SRR5423557.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 173 28.5996 Potri.005G024800.1.v4.1 1035 936 39 13.2183 Potri.004G059700.1.v4.1 961 862 6 2.20817 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 68.3794 7.62753 Potri.016G087400.1.v4.1 270 171 184 341.358 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 11 2.08461 Potri.012G127500.1.v4.1 977 878 1973 712.887 ==> SRR5423557.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 104 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 20 SRR5423557 completed mapping pipeline successfully