Starting /dee2/code/volunteer_pipeline.sh SRR5423558 current disk space = 3089970413568 free memory = 1455122500 SRR5423558 SRAfilesize 1c56eabfbd7ff49873fbfa7ec456f277 SRR5423558.sra SRR5423558.sra file validated SRR5423558 is single end SRR5423558 is conventional basespace SRR5423558 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423558_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4515 31.0 31.0 34.0 28.0 34.0 2 31.936 33.0 31.0 34.0 30.0 34.0 3 32.041 34.0 31.0 34.0 30.0 34.0 4 31.62825 35.0 30.0 37.0 19.0 37.0 5 34.4485 35.0 33.0 37.0 30.0 37.0 6 35.188 37.0 35.0 37.0 32.0 37.0 7 35.4905 37.0 35.0 37.0 33.0 37.0 8 35.60675 37.0 35.0 37.0 33.0 37.0 9 37.28775 39.0 37.0 39.0 34.0 39.0 10 37.263 39.0 37.0 39.0 33.0 39.0 11 37.426 39.0 37.0 39.0 34.0 39.0 12 37.35175 39.0 37.0 39.0 34.0 39.0 13 37.26575 39.0 37.0 39.0 34.0 39.0 14 38.64 40.0 38.0 41.0 34.0 41.0 15 38.55425 40.0 38.0 41.0 34.0 41.0 16 38.6555 40.0 38.0 41.0 34.0 41.0 17 38.5815 40.0 38.0 41.0 34.0 41.0 18 38.573 40.0 38.0 41.0 34.0 41.0 19 38.57225 40.0 38.0 41.0 34.0 41.0 20 38.514 40.0 38.0 41.0 34.0 41.0 21 38.5325 40.0 38.0 41.0 34.0 41.0 22 38.60875 40.0 38.0 41.0 34.0 41.0 23 38.6325 40.0 38.0 41.0 34.0 41.0 24 38.674 40.0 38.0 41.0 34.0 41.0 25 38.61025 40.0 38.0 41.0 34.0 41.0 26 38.46575 40.0 38.0 41.0 34.0 41.0 27 38.529 40.0 38.0 41.0 34.0 41.0 28 38.5885 40.0 38.0 41.0 34.0 41.0 29 38.2455 40.0 38.0 41.0 34.0 41.0 30 38.408 40.0 38.0 41.0 34.0 41.0 31 38.508 40.0 38.0 41.0 34.0 41.0 32 38.50725 40.0 38.0 41.0 34.0 41.0 33 38.43175 40.0 38.0 41.0 34.0 41.0 34 38.1705 40.0 38.0 41.0 33.0 41.0 35 38.36275 40.0 38.0 41.0 34.0 41.0 36 38.32175 40.0 38.0 41.0 34.0 41.0 37 38.1215 40.0 38.0 41.0 33.0 41.0 38 38.073 40.0 38.0 41.0 33.0 41.0 39 38.19375 40.0 38.0 41.0 33.0 41.0 40 38.1975 40.0 38.0 41.0 33.0 41.0 41 38.127 40.0 38.0 41.0 33.0 41.0 42 38.021 40.0 37.0 41.0 33.0 41.0 43 37.965 40.0 37.0 41.0 33.0 41.0 44 38.008 40.0 37.0 41.0 33.0 41.0 45 37.82325 40.0 37.0 41.0 32.0 41.0 46 37.8515 40.0 37.0 41.0 33.0 41.0 47 37.7135 40.0 37.0 41.0 32.0 41.0 48 37.73575 40.0 37.0 41.0 32.0 41.0 49 37.70125 40.0 37.0 41.0 32.0 41.0 50 37.691 40.0 37.0 41.0 32.0 41.0 51 37.738 40.0 37.0 41.0 33.0 41.0 52 36.88275 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1214 1 0.0 1214 2 0.0 1214 3 0.0 1214 4 0.0 1214 5 0.0 1214 6 0.0 1214 7 0.0 1214 8 0.0 1214 9 0.0 1214 10 0.0 1214 11 0.0 1214 12 0.0 1214 13 0.0 1214 14 0.0 1214 15 0.0 1214 16 0.0 1214 17 0.0 1214 18 0.0 1214 19 0.0 1214 20 0.0 1214 21 0.0 1214 22 0.0 1214 23 0.0 1214 24 0.0 1214 25 0.0 1214 26 0.0 1214 27 0.0 1214 28 0.0 1214 29 0.0 1214 30 0.0 1214 31 0.0 1214 32 0.0 1214 33 0.0 1214 34 0.0 1214 35 0.0 1214 36 0.0 1214 37 0.0 1214 38 0.0 1214 39 0.0 1214 40 0.0 1214 41 0.0 1214 42 0.0 1214 43 0.0 1214 44 0.0 1214 45 0.0 1214 46 0.0 1214 47 0.0 1214 48 0.0 1214 49 0.0 1214 50 0.0 1214 51 0.0 1214 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 0.0 22 0.0 23 2.0 24 3.0 25 9.0 26 9.0 27 27.0 28 32.0 29 39.0 30 59.0 31 77.0 32 105.0 33 132.0 34 159.0 35 217.0 36 320.0 37 448.0 38 797.0 39 1551.0 40 12.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.1557336004006 11.266900350525788 5.883825738607912 45.6935403104657 2 21.025 16.675 36.199999999999996 26.1 3 21.0 18.55 24.4 36.05 4 24.349999999999998 25.4 24.175 26.075 5 23.849999999999998 31.65 23.9 20.599999999999998 6 18.75 31.65 24.9 24.7 7 14.875 22.875 41.15 21.099999999999998 8 16.975 22.325 32.775 27.925 9 18.375 19.5 34.5 27.625 10 18.475 35.25 25.7 20.575 11 23.0 27.500000000000004 21.825 27.675 12 20.549999999999997 22.525000000000002 28.249999999999996 28.675 13 20.325 26.275 28.849999999999998 24.55 14 19.475 26.75 28.575 25.2 15 20.95 26.3 27.250000000000004 25.5 16 20.925 25.874999999999996 26.55 26.650000000000002 17 20.875 27.275 26.0 25.85 18 19.625 26.450000000000003 27.1 26.825 19 21.725 26.150000000000002 27.450000000000003 24.675 20 21.2 26.55 27.55 24.7 21 19.654913728432106 26.481620405101275 27.506876719179797 26.356589147286826 22 20.75 24.875 26.950000000000003 27.425 23 20.849999999999998 25.674999999999997 28.375 25.1 24 20.9 23.925 28.375 26.8 25 20.75 26.75 26.8 25.7 26 21.175 26.424999999999997 27.725 24.675 27 21.9 24.75 26.700000000000003 26.650000000000002 28 18.825 27.224999999999998 27.750000000000004 26.200000000000003 29 20.5 26.474999999999998 27.175 25.85 30 21.65 24.925 26.6 26.825 31 20.625 26.35 27.325 25.7 32 20.525 26.150000000000002 27.1 26.224999999999998 33 19.875 26.525 27.375 26.224999999999998 34 20.775 25.0 27.325 26.900000000000002 35 20.925 24.875 28.15 26.05 36 21.05 24.025 26.924999999999997 28.000000000000004 37 21.6 25.624999999999996 27.3 25.474999999999998 38 21.349999999999998 25.775 27.325 25.55 39 20.825 25.900000000000002 26.775 26.5 40 21.425 26.700000000000003 26.224999999999998 25.650000000000002 41 22.25 24.775 27.500000000000004 25.474999999999998 42 20.8 25.025 28.125 26.05 43 21.0 25.775 27.575 25.650000000000002 44 21.95 25.650000000000002 26.3 26.1 45 20.375 25.1 26.950000000000003 27.575 46 21.224999999999998 26.450000000000003 25.474999999999998 26.85 47 21.875 25.35 27.1 25.674999999999997 48 21.180295073768445 24.406101525381345 26.881720430107524 27.53188297074269 49 20.980245061265315 25.756439109777446 26.85671417854464 26.406601650412604 50 21.175 25.8 26.825 26.200000000000003 51 21.380345086271568 24.15603900975244 26.756689172293076 27.70692673168292 52 21.405351337834457 26.081520380095025 26.78169542385596 25.731432858214554 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.5 19 2.0 20 2.0 21 2.0 22 3.0 23 4.0 24 10.0 25 16.0 26 14.5 27 13.0 28 16.0 29 19.0 30 30.0 31 41.0 32 63.0 33 85.0 34 87.0 35 89.0 36 119.0 37 149.0 38 173.5 39 226.5 40 255.0 41 261.0 42 267.0 43 317.5 44 368.0 45 363.0 46 358.0 47 390.0 48 422.0 49 397.5 50 373.0 51 361.0 52 349.0 53 320.0 54 291.0 55 264.5 56 238.0 57 191.5 58 145.0 59 129.0 60 113.0 61 92.0 62 71.0 63 60.0 64 38.5 65 28.0 66 25.5 67 23.0 68 19.0 69 15.0 70 9.0 71 3.0 72 4.5 73 6.0 74 5.5 75 5.0 76 3.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.0 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6303580433686334 1.25 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra Read 200000 spots for SRR5423558.sra Written 200000 spots for SRR5423558.sra SRR ids: ['SRR5423558.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_t7oa204e SRR5423558.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423558 file size 704015 SRR5423558 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423558 SRR5423558_1.fastq Input file: SRR5423558_1.fastq trimmed: SRR5423558-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:09:49 2025 >> started Thu Feb 13 14:09:51 2025 >> done (1.935s) 4000000 reads processed; of these: 207 ( 0.01%) short reads filtered out after trimming by size control 279 ( 0.01%) empty reads filtered out after trimming by size control 3999514 (99.99%) reads available; of these: 53784 ( 1.34%) trimmed reads available after processing 3945730 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 3 0.00% 20 5 0.00% 21 2 0.00% 22 0 0.00% 23 0 0.00% 24 3 0.00% 25 3 0.00% 26 7 0.00% 27 3 0.00% 28 5 0.00% 29 5 0.00% 30 11 0.00% 31 9 0.00% 32 16 0.00% 33 18 0.00% 34 27 0.00% 35 27 0.00% 36 26 0.00% 37 31 0.00% 38 45 0.00% 39 48 0.00% 40 82 0.00% 41 78 0.00% 42 111 0.00% 43 154 0.00% 44 174 0.00% 45 267 0.01% 46 383 0.01% 47 597 0.01% 48 1026 0.03% 49 2015 0.05% 50 5959 0.15% 51 42636 1.07% 52 3945730 98.66% 3999514 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=27 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=189.64 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=23.2 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:10:04 Started mapping on | Feb 13 14:10:04 Finished on | Feb 13 14:10:10 Mapping speed, Million of reads per hour | 2399.71 Number of input reads | 3999514 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3644240 Uniquely mapped reads % | 91.12% Average mapped length | 51.82 Number of splices: Total | 482268 Number of splices: Annotated (sjdb) | 474526 Number of splices: GT/AG | 475722 Number of splices: GC/AG | 5668 Number of splices: AT/AC | 346 Number of splices: Non-canonical | 532 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281657 % of reads mapped to multiple loci | 7.04% Number of reads mapped to too many loci | 43944 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73617 73617 73617 N_multimapping 281657 281657 281657 N_noFeature 127455 3612409 143419 N_ambiguous 26768 68 10875 UnstrandedReadsAssigned:3490017 PositiveStrandReadsAssigned:31763 NegativeStrandReadsAssigned:3489946 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423558 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423558-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,514 reads, 3,669,362 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,178 rounds 52401 SRR5423558.ke.tsv 34699 SRR5423558.se.tsv 87100 total ==> SRR5423558.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 169 27.9948 Potri.005G024800.1.v4.1 1035 936 32.0106 10.8713 Potri.004G059700.1.v4.1 961 862 12.5604 4.63194 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.9863 7.93432 Potri.016G087400.1.v4.1 270 171 171 317.881 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.4949 2.94238 Potri.012G127500.1.v4.1 977 878 1985 718.672 ==> SRR5423558.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 22 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 89 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 26 SRR5423558 completed mapping pipeline successfully