Starting /dee2/code/volunteer_pipeline.sh SRR5423559 current disk space = 3090103468032 free memory = 1450014544 SRR5423559 SRAfilesize c2b49b55c5b2c1662a938c0d8bbc0a19 SRR5423559.sra SRR5423559.sra file validated SRR5423559 is single end SRR5423559 is conventional basespace SRR5423559 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423559_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.55525 31.0 30.0 33.0 25.0 34.0 2 31.526 31.0 31.0 34.0 28.0 34.0 3 32.05575 33.0 31.0 34.0 30.0 34.0 4 28.52775 32.0 19.0 37.0 10.0 37.0 5 33.12375 35.0 32.0 37.0 28.0 37.0 6 34.74225 35.0 35.0 37.0 32.0 37.0 7 35.28775 37.0 35.0 37.0 33.0 37.0 8 35.515 37.0 35.0 37.0 33.0 37.0 9 37.469 39.0 37.0 39.0 35.0 39.0 10 37.541 39.0 37.0 39.0 35.0 39.0 11 37.52875 39.0 37.0 39.0 35.0 39.0 12 37.6355 39.0 37.0 39.0 35.0 39.0 13 37.579 39.0 37.0 39.0 35.0 39.0 14 38.81425 40.0 38.0 41.0 34.0 41.0 15 38.83075 40.0 38.0 41.0 35.0 41.0 16 38.714 40.0 38.0 41.0 34.0 41.0 17 38.827 40.0 38.0 41.0 35.0 41.0 18 38.8705 40.0 38.0 41.0 35.0 41.0 19 38.75125 40.0 38.0 41.0 34.0 41.0 20 38.79025 40.0 38.0 41.0 34.0 41.0 21 38.83075 40.0 38.0 41.0 35.0 41.0 22 38.8665 40.0 38.0 41.0 35.0 41.0 23 38.71275 40.0 38.0 41.0 34.0 41.0 24 38.656 40.0 38.0 41.0 34.0 41.0 25 38.694 40.0 38.0 41.0 34.0 41.0 26 38.827 40.0 38.0 41.0 35.0 41.0 27 38.861 40.0 38.0 41.0 35.0 41.0 28 38.71475 40.0 38.0 41.0 35.0 41.0 29 38.874 40.0 38.0 41.0 35.0 41.0 30 38.6175 40.0 38.0 41.0 34.0 41.0 31 38.606 40.0 38.0 41.0 34.0 41.0 32 38.63125 40.0 38.0 41.0 34.0 41.0 33 38.5455 40.0 38.0 41.0 34.0 41.0 34 38.53475 40.0 38.0 41.0 34.0 41.0 35 38.5355 40.0 38.0 41.0 34.0 41.0 36 38.4125 40.0 38.0 41.0 34.0 41.0 37 38.38925 40.0 38.0 41.0 34.0 41.0 38 38.4755 40.0 38.0 41.0 34.0 41.0 39 38.51875 40.0 38.0 41.0 34.0 41.0 40 38.2425 40.0 38.0 41.0 33.0 41.0 41 38.20175 40.0 38.0 41.0 33.0 41.0 42 37.9695 40.0 38.0 41.0 33.0 41.0 43 38.0605 40.0 38.0 41.0 33.0 41.0 44 38.06875 40.0 38.0 41.0 33.0 41.0 45 38.0935 40.0 37.0 41.0 33.0 41.0 46 37.748 40.0 37.0 41.0 33.0 41.0 47 37.74075 40.0 37.0 41.0 33.0 41.0 48 37.841 40.0 37.0 41.0 33.0 41.0 49 37.823 40.0 37.0 41.0 33.0 41.0 50 37.71575 40.0 37.0 41.0 32.0 41.0 51 37.5955 40.0 37.0 41.0 32.0 41.0 52 36.376 39.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1308 1 0.0 1308 2 0.0 1308 3 0.0 1308 4 0.0 1308 5 0.0 1308 6 0.0 1308 7 0.0 1308 8 0.0 1308 9 0.0 1308 10 0.0 1308 11 0.0 1308 12 0.0 1308 13 0.0 1308 14 0.0 1308 15 0.0 1308 16 0.0 1308 17 0.0 1308 18 0.0 1308 19 0.0 1308 20 0.0 1308 21 0.0 1308 22 0.0 1308 23 0.0 1308 24 0.0 1308 25 0.0 1308 26 0.0 1308 27 0.0 1308 28 0.0 1308 29 0.0 1308 30 0.0 1308 31 0.0 1308 32 0.0 1308 33 0.0 1308 34 0.0 1308 35 0.0 1308 36 0.0 1308 37 0.0 1308 38 0.0 1308 39 0.0 1308 40 0.0 1308 41 0.0 1308 42 0.0 1308 43 0.0 1308 44 0.0 1308 45 0.0 1308 46 0.0 1308 47 0.0 1308 48 0.0 1308 49 0.0 1308 50 0.0 1308 51 0.0 1308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 0.0 21 0.0 22 1.0 23 2.0 24 7.0 25 17.0 26 15.0 27 13.0 28 28.0 29 42.0 30 43.0 31 68.0 32 106.0 33 101.0 34 155.0 35 202.0 36 311.0 37 470.0 38 966.0 39 1443.0 40 4.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.23823823823824 11.611611611611613 6.431431431431431 43.71871871871872 2 21.6 15.35 36.675000000000004 26.375 3 20.474999999999998 17.775 24.95 36.8 4 25.900000000000002 24.474999999999998 26.25 23.375 5 24.25 30.725 24.175 20.849999999999998 6 17.825 32.275 25.724999999999998 24.175 7 13.750000000000002 23.825 44.0 18.425 8 17.575 21.6 32.125 28.7 9 17.875 20.9 33.925 27.3 10 18.9 36.0 25.15 19.950000000000003 11 22.625 26.1 23.200000000000003 28.075 12 21.5 24.325 27.875 26.3 13 19.950000000000003 26.525 27.55 25.974999999999998 14 20.575 25.05 29.025000000000002 25.35 15 20.125 24.775 27.750000000000004 27.35 16 20.3 25.924999999999997 27.800000000000004 25.974999999999998 17 20.7 27.025 26.450000000000003 25.825 18 20.200000000000003 26.85 25.775 27.175 19 20.525 26.525 26.575 26.375 20 21.05 25.074999999999996 27.950000000000003 25.924999999999997 21 20.599999999999998 25.174999999999997 28.425 25.8 22 22.0 25.825 26.974999999999998 25.2 23 21.8 25.775 27.325 25.1 24 20.05 26.525 26.700000000000003 26.724999999999998 25 20.5 27.200000000000003 27.075 25.224999999999998 26 20.825 26.0 26.924999999999997 26.25 27 20.125 24.4 27.950000000000003 27.525 28 20.424999999999997 26.674999999999997 27.975 24.925 29 20.45 25.4 28.275 25.874999999999996 30 22.125 24.95 26.575 26.35 31 20.825 26.875 26.55 25.75 32 21.025 25.35 28.125 25.5 33 21.0 23.400000000000002 27.625 27.975 34 20.375 26.075 26.55 27.0 35 22.5 25.95 27.150000000000002 24.4 36 20.5 24.7 27.85 26.950000000000003 37 21.075 24.925 26.3 27.700000000000003 38 21.075 25.874999999999996 27.675 25.374999999999996 39 20.45 25.55 25.75 28.249999999999996 40 21.075 28.4 25.825 24.7 41 22.05 25.124999999999996 27.900000000000002 24.925 42 20.5 26.0 27.650000000000002 25.85 43 21.3 26.025 26.424999999999997 26.25 44 21.85 24.4 27.325 26.424999999999997 45 21.275 24.575 27.275 26.875 46 21.975 24.224999999999998 28.125 25.674999999999997 47 21.425 25.15 26.900000000000002 26.525 48 20.7 24.975 26.674999999999997 27.650000000000002 49 20.674999999999997 25.624999999999996 25.924999999999997 27.775 50 21.125 26.0 26.424999999999997 26.450000000000003 51 20.150000000000002 24.625 26.625 28.599999999999998 52 21.775 25.25 26.075 26.900000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 3.0 20 3.5 21 4.0 22 4.0 23 4.0 24 4.5 25 5.0 26 15.5 27 26.0 28 26.5 29 27.0 30 31.0 31 35.0 32 59.0 33 83.0 34 97.0 35 111.0 36 131.5 37 152.0 38 155.0 39 204.0 40 250.0 41 277.5 42 305.0 43 323.5 44 342.0 45 360.0 46 378.0 47 377.0 48 376.0 49 379.5 50 383.0 51 363.5 52 344.0 53 321.0 54 298.0 55 266.5 56 235.0 57 202.0 58 169.0 59 138.5 60 108.0 61 90.5 62 73.0 63 64.5 64 39.5 65 23.0 66 21.5 67 20.0 68 15.5 69 11.0 70 10.0 71 9.0 72 6.5 73 4.0 74 4.5 75 5.0 76 3.5 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31921331316188 98.475 2 0.6051437216338881 1.2 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.02521432173474534 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra Read 200000 spots for SRR5423559.sra Written 200000 spots for SRR5423559.sra SRR ids: ['SRR5423559.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a4ln8npg SRR5423559.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423559 file size 703958 SRR5423559 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423559 SRR5423559_1.fastq Input file: SRR5423559_1.fastq trimmed: SRR5423559-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:01:29 2025 >> started Thu Feb 13 14:01:31 2025 >> done (2.493s) 4000000 reads processed; of these: 207 ( 0.01%) short reads filtered out after trimming by size control 258 ( 0.01%) empty reads filtered out after trimming by size control 3999535 (99.99%) reads available; of these: 51226 ( 1.28%) trimmed reads available after processing 3948309 (98.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 7 0.00% 20 4 0.00% 21 1 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 2 0.00% 28 5 0.00% 29 5 0.00% 30 5 0.00% 31 1 0.00% 32 7 0.00% 33 17 0.00% 34 9 0.00% 35 12 0.00% 36 35 0.00% 37 15 0.00% 38 21 0.00% 39 18 0.00% 40 48 0.00% 41 52 0.00% 42 59 0.00% 43 77 0.00% 44 110 0.00% 45 183 0.00% 46 274 0.01% 47 428 0.01% 48 740 0.02% 49 1669 0.04% 50 5344 0.13% 51 42065 1.05% 52 3948309 98.72% 3999535 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=29 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=198.21 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.6 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:01:45 Started mapping on | Feb 13 14:01:45 Finished on | Feb 13 14:01:51 Mapping speed, Million of reads per hour | 2399.72 Number of input reads | 3999535 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3645565 Uniquely mapped reads % | 91.15% Average mapped length | 51.82 Number of splices: Total | 483077 Number of splices: Annotated (sjdb) | 475357 Number of splices: GT/AG | 476337 Number of splices: GC/AG | 5869 Number of splices: AT/AC | 324 Number of splices: Non-canonical | 547 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281032 % of reads mapped to multiple loci | 7.03% Number of reads mapped to too many loci | 44071 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72938 72938 72938 N_multimapping 281032 281032 281032 N_noFeature 127973 3613858 143487 N_ambiguous 27075 48 10862 UnstrandedReadsAssigned:3490517 PositiveStrandReadsAssigned:31659 NegativeStrandReadsAssigned:3491216 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423559 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423559-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,535 reads, 3,666,167 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR5423559.ke.tsv 34699 SRR5423559.se.tsv 87100 total ==> SRR5423559.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 165 27.313 Potri.005G024800.1.v4.1 1035 936 30.0101 10.1848 Potri.004G059700.1.v4.1 961 862 6 2.21108 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 72.7466 8.12539 Potri.016G087400.1.v4.1 270 171 183 339.951 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 13.4788 2.55775 Potri.012G127500.1.v4.1 977 878 1948 704.782 ==> SRR5423559.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 84 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR5423559 completed mapping pipeline successfully