Starting /dee2/code/volunteer_pipeline.sh SRR5423560 current disk space = 3089992921088 free memory = 1485416528 SRR5423560 SRAfilesize e35928f0697413b5209b8d1a4658e4cf SRR5423560.sra SRR5423560.sra file validated SRR5423560 is single end SRR5423560 is conventional basespace SRR5423560 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423560_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.653 34.0 31.0 34.0 31.0 34.0 2 32.7745 34.0 31.0 34.0 31.0 34.0 3 32.80725 34.0 31.0 34.0 31.0 34.0 4 36.24025 37.0 37.0 37.0 35.0 37.0 5 36.2075 37.0 37.0 37.0 35.0 37.0 6 36.12525 37.0 37.0 37.0 35.0 37.0 7 36.1625 37.0 36.0 37.0 35.0 37.0 8 36.116 37.0 37.0 37.0 35.0 37.0 9 37.8735 39.0 38.0 39.0 35.0 39.0 10 37.884 39.0 38.0 39.0 35.0 39.0 11 37.78675 39.0 38.0 39.0 35.0 39.0 12 37.9385 39.0 38.0 39.0 35.0 39.0 13 37.88975 39.0 38.0 39.0 35.0 39.0 14 39.3145 41.0 39.0 41.0 36.0 41.0 15 39.40225 41.0 39.0 41.0 36.0 41.0 16 39.39425 41.0 39.0 41.0 36.0 41.0 17 39.26125 41.0 39.0 41.0 36.0 41.0 18 39.25025 41.0 39.0 41.0 36.0 41.0 19 39.3645 41.0 39.0 41.0 36.0 41.0 20 39.3775 41.0 39.0 41.0 37.0 41.0 21 39.36675 41.0 39.0 41.0 36.0 41.0 22 39.228 40.0 39.0 41.0 36.0 41.0 23 39.2395 40.0 39.0 41.0 36.0 41.0 24 39.135 40.0 39.0 41.0 36.0 41.0 25 39.27375 40.0 39.0 41.0 36.0 41.0 26 39.0385 40.0 39.0 41.0 36.0 41.0 27 39.10625 40.0 39.0 41.0 36.0 41.0 28 39.14675 41.0 39.0 41.0 36.0 41.0 29 38.997 40.0 39.0 41.0 36.0 41.0 30 38.94175 40.0 39.0 41.0 36.0 41.0 31 38.98 40.0 39.0 41.0 35.0 41.0 32 39.002 40.0 39.0 41.0 36.0 41.0 33 38.9545 40.0 39.0 41.0 35.0 41.0 34 38.9325 40.0 39.0 41.0 35.0 41.0 35 38.9455 40.0 39.0 41.0 35.0 41.0 36 38.742 40.0 38.0 41.0 35.0 41.0 37 38.67525 40.0 38.0 41.0 35.0 41.0 38 38.71425 40.0 38.0 41.0 35.0 41.0 39 38.684 40.0 38.0 41.0 35.0 41.0 40 38.34175 40.0 38.0 41.0 34.0 41.0 41 38.3965 40.0 38.0 41.0 34.0 41.0 42 38.397 40.0 38.0 41.0 34.0 41.0 43 38.29875 40.0 38.0 41.0 34.0 41.0 44 38.21225 40.0 38.0 41.0 34.0 41.0 45 38.0495 40.0 38.0 41.0 33.0 41.0 46 38.15975 40.0 38.0 41.0 33.0 41.0 47 38.0635 40.0 38.0 41.0 33.0 41.0 48 38.08925 40.0 38.0 41.0 33.0 41.0 49 37.9685 40.0 38.0 41.0 33.0 41.0 50 37.9705 40.0 38.0 41.0 33.0 41.0 51 37.8715 40.0 37.0 41.0 33.0 41.0 52 36.682 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2102 1 0.0 2102 2 0.0 2102 3 0.0 2102 4 0.0 2102 5 0.0 2102 6 0.0 2102 7 0.0 2102 8 0.0 2102 9 0.0 2102 10 0.0 2102 11 0.0 2102 12 0.0 2102 13 0.0 2102 14 0.0 2102 15 0.0 2102 16 0.0 2102 17 0.0 2102 18 0.0 2102 19 0.0 2102 20 0.0 2102 21 0.0 2102 22 0.0 2102 23 0.0 2102 24 0.0 2102 25 0.0 2102 26 0.0 2102 27 0.0 2102 28 0.0 2102 29 0.0 2102 30 0.0 2102 31 0.0 2102 32 0.0 2102 33 0.0 2102 34 0.0 2102 35 0.0 2102 36 0.0 2102 37 0.0 2102 38 0.0 2102 39 0.0 2102 40 0.0 2102 41 0.0 2102 42 0.0 2102 43 0.0 2102 44 0.0 2102 45 0.0 2102 46 0.0 2102 47 0.0 2102 48 0.0 2102 49 0.0 2102 50 0.0 2102 51 0.0 2102 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 1.0 20 0.0 21 2.0 22 1.0 23 4.0 24 2.0 25 12.0 26 10.0 27 15.0 28 13.0 29 23.0 30 42.0 31 54.0 32 61.0 33 72.0 34 120.0 35 135.0 36 227.0 37 329.0 38 715.0 39 2148.0 40 12.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.957852483692925 11.590566984445559 5.845459106874059 44.60612142498746 2 21.375 14.7 37.775 26.150000000000002 3 21.375 17.549999999999997 25.275 35.8 4 24.099999999999998 27.275 22.400000000000002 26.224999999999998 5 24.725 31.775 22.875 20.625 6 18.85 32.25 24.75 24.15 7 15.1 21.775 43.5 19.625 8 17.224999999999998 22.15 31.7 28.925 9 17.8 20.724999999999998 34.175 27.3 10 18.825 34.8 26.6 19.775000000000002 11 22.775000000000002 25.2 23.275000000000002 28.749999999999996 12 21.349999999999998 23.875 26.575 28.199999999999996 13 20.849999999999998 25.374999999999996 28.349999999999998 25.424999999999997 14 19.400000000000002 26.25 28.275 26.075 15 19.85 25.174999999999997 27.85 27.125 16 20.5 26.625 26.424999999999997 26.450000000000003 17 21.475 26.974999999999998 26.3 25.25 18 21.975 25.0 26.450000000000003 26.575 19 21.15 26.6 25.95 26.3 20 21.349999999999998 25.650000000000002 26.75 26.25 21 20.375 24.224999999999998 28.225 27.175 22 20.375 25.95 27.725 25.95 23 21.525 25.95 27.250000000000004 25.275 24 21.775 25.825 26.85 25.55 25 20.65 25.074999999999996 28.349999999999998 25.924999999999997 26 20.575 25.575 27.250000000000004 26.6 27 20.175 25.75 28.449999999999996 25.624999999999996 28 20.549999999999997 25.05 27.425 26.974999999999998 29 20.175 26.35 26.700000000000003 26.775 30 20.4 25.474999999999998 27.400000000000002 26.724999999999998 31 20.4 26.950000000000003 26.775 25.874999999999996 32 21.55 24.875 27.0 26.575 33 20.65 24.8 26.900000000000002 27.650000000000002 34 21.5 26.224999999999998 25.8 26.474999999999998 35 21.15 25.374999999999996 27.35 26.125 36 20.375 25.3 28.425 25.900000000000002 37 19.525000000000002 26.0 26.674999999999997 27.800000000000004 38 22.0 25.2 26.375 26.424999999999997 39 21.3 24.725 26.674999999999997 27.3 40 21.05 26.174999999999997 26.900000000000002 25.874999999999996 41 21.825 24.725 27.224999999999998 26.224999999999998 42 20.375 24.425 28.175 27.025 43 21.5 26.8 25.35 26.35 44 21.175 25.35 27.200000000000003 26.275 45 20.95 23.974999999999998 28.000000000000004 27.075 46 20.4 24.875 26.924999999999997 27.800000000000004 47 20.535267633816908 25.41270635317659 28.01400700350175 26.038019009504755 48 20.885442721360683 23.6368184092046 27.613806903451728 27.863931965982992 49 21.25 25.575 27.275 25.900000000000002 50 22.05 24.775 27.0 26.174999999999997 51 20.625 24.9 26.8 27.675 52 22.125 25.35 25.95 26.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 2.0 22 2.0 23 2.0 24 8.0 25 14.0 26 12.5 27 11.0 28 15.5 29 20.0 30 34.5 31 49.0 32 55.5 33 62.0 34 81.0 35 100.0 36 114.5 37 129.0 38 154.0 39 203.5 40 228.0 41 258.0 42 288.0 43 318.0 44 348.0 45 372.0 46 396.0 47 388.0 48 380.0 49 378.0 50 376.0 51 387.5 52 399.0 53 360.0 54 321.0 55 277.0 56 233.0 57 194.0 58 155.0 59 133.0 60 111.0 61 90.0 62 69.0 63 56.5 64 34.5 65 25.0 66 23.5 67 22.0 68 14.5 69 7.0 70 8.5 71 10.0 72 8.0 73 6.0 74 6.0 75 6.0 76 3.5 77 1.0 78 2.0 79 3.0 80 1.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.35000000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.05 48 0.05 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03846153846155 97.85000000000001 2 0.7591093117408907 1.5 3 0.1771255060728745 0.525 4 0.0 0.0 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra Read 200000 spots for SRR5423560.sra Written 200000 spots for SRR5423560.sra SRR ids: ['SRR5423560.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_77x5v43p SRR5423560.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423560 file size 703952 SRR5423560 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423560 SRR5423560_1.fastq Input file: SRR5423560_1.fastq trimmed: SRR5423560-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:16:37 2025 >> started Thu Feb 13 14:16:38 2025 >> done (1.875s) 4000000 reads processed; of these: 187 ( 0.00%) short reads filtered out after trimming by size control 245 ( 0.01%) empty reads filtered out after trimming by size control 3999568 (99.99%) reads available; of these: 52406 ( 1.31%) trimmed reads available after processing 3947162 (98.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 4 0.00% 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 3 0.00% 27 6 0.00% 28 3 0.00% 29 9 0.00% 30 4 0.00% 31 14 0.00% 32 22 0.00% 33 28 0.00% 34 24 0.00% 35 28 0.00% 36 37 0.00% 37 44 0.00% 38 42 0.00% 39 58 0.00% 40 67 0.00% 41 81 0.00% 42 119 0.00% 43 160 0.00% 44 239 0.01% 45 278 0.01% 46 440 0.01% 47 657 0.02% 48 1081 0.03% 49 2152 0.05% 50 5881 0.15% 51 40903 1.02% 52 3947162 98.69% 3999568 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=6.20 fanout-score-rank=12 prefix-density=0.42 prefix-fanout=1.6 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=192.99 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=21.7 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:16:52 Started mapping on | Feb 13 14:16:52 Finished on | Feb 13 14:16:57 Mapping speed, Million of reads per hour | 2879.69 Number of input reads | 3999568 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3642528 Uniquely mapped reads % | 91.07% Average mapped length | 51.82 Number of splices: Total | 482692 Number of splices: Annotated (sjdb) | 474891 Number of splices: GT/AG | 476049 Number of splices: GC/AG | 5779 Number of splices: AT/AC | 315 Number of splices: Non-canonical | 549 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 283524 % of reads mapped to multiple loci | 7.09% Number of reads mapped to too many loci | 43348 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73516 73516 73516 N_multimapping 283524 283524 283524 N_noFeature 126723 3610682 142325 N_ambiguous 27178 59 10912 UnstrandedReadsAssigned:3488627 PositiveStrandReadsAssigned:31787 NegativeStrandReadsAssigned:3489291 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423560 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423560-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,568 reads, 3,668,287 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR5423560.ke.tsv 34699 SRR5423560.se.tsv 87100 total ==> SRR5423560.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 154 25.5019 Potri.005G024800.1.v4.1 1035 936 30 10.1852 Potri.004G059700.1.v4.1 961 862 3 1.10596 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 66.9122 7.47656 Potri.016G087400.1.v4.1 270 171 184 341.938 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.7786 2.80546 Potri.012G127500.1.v4.1 977 878 2005 725.681 ==> SRR5423560.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 101 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR5423560 completed mapping pipeline successfully