Starting /dee2/code/volunteer_pipeline.sh SRR5423561 current disk space = 3051975151616 free memory = 1443017604 SRR5423561 SRAfilesize 9744a6399726bb771b2435cc623ebf93 SRR5423561.sra SRR5423561.sra file validated SRR5423561 is single end SRR5423561 is conventional basespace SRR5423561 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.176 34.0 31.0 34.0 30.0 34.0 2 32.3625 34.0 31.0 34.0 30.0 34.0 3 32.34075 34.0 31.0 34.0 30.0 34.0 4 35.80475 37.0 35.0 37.0 33.0 37.0 5 35.8415 37.0 35.0 37.0 33.0 37.0 6 35.8315 37.0 35.0 37.0 33.0 37.0 7 35.8205 37.0 35.0 37.0 35.0 37.0 8 35.8635 37.0 35.0 37.0 35.0 37.0 9 37.3595 39.0 37.0 39.0 34.0 39.0 10 37.47925 39.0 37.0 39.0 35.0 39.0 11 37.3565 39.0 37.0 39.0 34.0 39.0 12 37.45225 39.0 37.0 39.0 34.0 39.0 13 37.42275 39.0 37.0 39.0 34.0 39.0 14 38.59625 40.0 38.0 41.0 34.0 41.0 15 38.649 40.0 38.0 41.0 34.0 41.0 16 38.604 40.0 38.0 41.0 34.0 41.0 17 38.657 40.0 38.0 41.0 34.0 41.0 18 38.48125 40.0 38.0 41.0 34.0 41.0 19 38.7245 40.0 38.0 41.0 34.0 41.0 20 38.7795 40.0 38.0 41.0 35.0 41.0 21 38.8015 40.0 38.0 41.0 35.0 41.0 22 38.5235 40.0 38.0 41.0 34.0 41.0 23 38.66625 40.0 38.0 41.0 34.0 41.0 24 38.658 40.0 38.0 41.0 34.0 41.0 25 38.71525 40.0 38.0 41.0 34.0 41.0 26 38.548 40.0 38.0 41.0 34.0 41.0 27 38.6065 40.0 38.0 41.0 34.0 41.0 28 38.52225 40.0 38.0 41.0 34.0 41.0 29 38.4935 40.0 38.0 41.0 34.0 41.0 30 38.57975 40.0 38.0 41.0 34.0 41.0 31 38.52275 40.0 38.0 41.0 34.0 41.0 32 38.42075 40.0 38.0 41.0 34.0 41.0 33 38.53375 40.0 38.0 41.0 34.0 41.0 34 38.50325 40.0 38.0 41.0 34.0 41.0 35 38.342 40.0 38.0 41.0 34.0 41.0 36 38.19575 40.0 38.0 41.0 33.0 41.0 37 38.12525 40.0 38.0 41.0 33.0 41.0 38 38.208 40.0 38.0 41.0 33.0 41.0 39 38.148 40.0 38.0 41.0 33.0 41.0 40 38.007 40.0 38.0 41.0 33.0 41.0 41 38.103 40.0 37.0 41.0 33.0 41.0 42 37.83175 40.0 37.0 41.0 33.0 41.0 43 37.61575 40.0 37.0 41.0 32.0 41.0 44 37.73875 40.0 37.0 41.0 32.0 41.0 45 37.79925 40.0 37.0 41.0 33.0 41.0 46 37.885 40.0 37.0 41.0 33.0 41.0 47 37.63375 40.0 37.0 41.0 32.0 41.0 48 37.6075 40.0 37.0 41.0 33.0 41.0 49 37.731 40.0 37.0 41.0 32.0 41.0 50 37.7585 40.0 37.0 41.0 33.0 41.0 51 37.76075 40.0 37.0 41.0 33.0 41.0 52 36.74675 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2112 1 0.0 2112 2 0.0 2112 3 0.0 2112 4 0.0 2112 5 0.0 2112 6 0.0 2112 7 0.0 2112 8 0.0 2112 9 0.0 2112 10 0.0 2112 11 0.0 2112 12 0.0 2112 13 0.0 2112 14 0.0 2112 15 0.0 2112 16 0.0 2112 17 0.0 2112 18 0.0 2112 19 0.0 2112 20 0.0 2112 21 0.0 2112 22 0.0 2112 23 0.0 2112 24 0.0 2112 25 0.0 2112 26 0.0 2112 27 0.0 2112 28 0.0 2112 29 0.0 2112 30 0.0 2112 31 0.0 2112 32 0.0 2112 33 0.0 2112 34 0.0 2112 35 0.0 2112 36 0.0 2112 37 0.0 2112 38 0.0 2112 39 0.0 2112 40 0.0 2112 41 0.0 2112 42 0.0 2112 43 0.0 2112 44 0.0 2112 45 0.0 2112 46 0.0 2112 47 0.0 2112 48 0.0 2112 49 0.0 2112 50 0.0 2112 51 0.0 2112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 2.0 24 3.0 25 7.0 26 11.0 27 20.0 28 20.0 29 35.0 30 53.0 31 72.0 32 93.0 33 111.0 34 151.0 35 223.0 36 277.0 37 431.0 38 767.0 39 1702.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.0060135304435 11.425707842645954 6.840390879478828 45.72788774743172 2 22.175 15.2 36.35 26.275 3 20.65 17.974999999999998 24.25 37.125 4 23.225 26.875 21.875 28.025 5 22.975 30.4 25.15 21.475 6 17.7 33.225 24.85 24.224999999999998 7 15.299999999999999 23.200000000000003 42.525 18.975 8 17.0 21.45 32.6 28.95 9 16.1 22.825 34.849999999999994 26.224999999999998 10 19.400000000000002 36.475 24.875 19.25 11 23.175 26.025 22.1 28.7 12 21.275 23.0 27.950000000000003 27.775 13 20.025000000000002 26.974999999999998 28.299999999999997 24.7 14 19.875 24.95 28.975 26.200000000000003 15 19.650000000000002 25.674999999999997 27.800000000000004 26.875 16 21.175 26.025 26.700000000000003 26.1 17 22.15 26.200000000000003 26.125 25.525 18 20.225 25.8 27.700000000000003 26.275 19 21.45 26.8 26.200000000000003 25.55 20 21.175 25.35 27.900000000000002 25.575 21 20.150000000000002 26.1 26.8 26.950000000000003 22 21.025 25.45 27.35 26.174999999999997 23 19.825 27.35 28.125 24.7 24 20.45 23.849999999999998 27.925 27.775 25 20.7 24.975 27.200000000000003 27.125 26 21.175 26.35 27.275 25.2 27 20.075000000000003 24.825 28.575 26.525 28 21.575 26.150000000000002 26.775 25.5 29 20.349999999999998 25.074999999999996 28.65 25.924999999999997 30 20.825 24.4 27.800000000000004 26.974999999999998 31 21.9 26.450000000000003 27.075 24.575 32 20.1 27.650000000000002 26.974999999999998 25.275 33 21.425 24.575 27.375 26.625 34 21.475 24.775 27.55 26.200000000000003 35 21.15 25.525 27.0 26.325 36 20.325 25.724999999999998 26.5 27.450000000000003 37 20.375 27.725 27.200000000000003 24.7 38 22.05 25.75 26.5 25.7 39 21.0 25.074999999999996 27.474999999999998 26.450000000000003 40 21.55 25.825 26.6 26.025 41 21.925 26.525 27.05 24.5 42 20.9 25.124999999999996 26.8 27.175 43 22.175 25.874999999999996 26.200000000000003 25.75 44 21.325 25.474999999999998 27.800000000000004 25.4 45 21.7 25.025 26.85 26.424999999999997 46 20.974999999999998 24.9 26.875 27.250000000000004 47 21.099999999999998 25.45 27.05 26.400000000000002 48 22.1 24.025 27.950000000000003 25.924999999999997 49 21.5 26.200000000000003 25.75 26.55 50 21.325 24.575 26.924999999999997 27.175 51 21.075 24.349999999999998 27.525 27.05 52 21.475 25.0 26.075 27.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.5 21 3.0 22 5.5 23 8.0 24 9.0 25 10.0 26 17.0 27 24.0 28 26.5 29 29.0 30 34.0 31 39.0 32 68.5 33 98.0 34 101.5 35 105.0 36 122.0 37 139.0 38 159.5 39 205.5 40 231.0 41 272.5 42 314.0 43 315.5 44 317.0 45 331.5 46 346.0 47 363.5 48 381.0 49 375.5 50 370.0 51 376.5 52 383.0 53 327.0 54 271.0 55 251.0 56 231.0 57 214.0 58 197.0 59 164.5 60 132.0 61 101.5 62 71.0 63 53.0 64 31.5 65 28.0 66 25.0 67 22.0 68 18.0 69 14.0 70 12.5 71 11.0 72 7.5 73 4.0 74 3.5 75 3.0 76 1.5 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.5800756620428752 1.15 3 0.07566204287515763 0.22499999999999998 4 0.05044136191677175 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra Read 200000 spots for SRR5423561.sra Written 200000 spots for SRR5423561.sra SRR ids: ['SRR5423561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rbo2uejw SRR5423561.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423561 file size 703975 SRR5423561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423561 SRR5423561_1.fastq Input file: SRR5423561_1.fastq trimmed: SRR5423561-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:48:58 2025 >> started Wed Feb 12 16:49:01 2025 >> done (2.910s) 4000000 reads processed; of these: 172 ( 0.00%) short reads filtered out after trimming by size control 310 ( 0.01%) empty reads filtered out after trimming by size control 3999518 (99.99%) reads available; of these: 55773 ( 1.39%) trimmed reads available after processing 3943745 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 11 0.00% 20 9 0.00% 21 0 0.00% 22 3 0.00% 23 1 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 1 0.00% 28 6 0.00% 29 5 0.00% 30 7 0.00% 31 9 0.00% 32 15 0.00% 33 20 0.00% 34 23 0.00% 35 23 0.00% 36 39 0.00% 37 38 0.00% 38 39 0.00% 39 51 0.00% 40 64 0.00% 41 94 0.00% 42 99 0.00% 43 149 0.00% 44 222 0.01% 45 264 0.01% 46 427 0.01% 47 657 0.02% 48 1087 0.03% 49 2358 0.06% 50 6794 0.17% 51 43240 1.08% 52 3943745 98.61% 3999518 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=6.21 fanout-score-rank=10 prefix-density=0.41 prefix-fanout=1.6 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=209.15 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.7 sequence=CTTCTTCTTCTC Started job on | Feb 12 16:49:14 Started mapping on | Feb 12 16:49:14 Finished on | Feb 12 16:49:20 Mapping speed, Million of reads per hour | 2399.71 Number of input reads | 3999518 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3645027 Uniquely mapped reads % | 91.14% Average mapped length | 51.82 Number of splices: Total | 482013 Number of splices: Annotated (sjdb) | 474174 Number of splices: GT/AG | 475394 Number of splices: GC/AG | 5665 Number of splices: AT/AC | 343 Number of splices: Non-canonical | 611 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 280615 % of reads mapped to multiple loci | 7.02% Number of reads mapped to too many loci | 43582 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.75% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73876 73876 73876 N_multimapping 280615 280615 280615 N_noFeature 127367 3613251 142898 N_ambiguous 27118 65 10852 UnstrandedReadsAssigned:3490542 PositiveStrandReadsAssigned:31711 NegativeStrandReadsAssigned:3491277 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423561 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423561-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,518 reads, 3,650,889 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52401 SRR5423561.ke.tsv 34699 SRR5423561.se.tsv 87100 total ==> SRR5423561.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 180 29.9429 Potri.005G024800.1.v4.1 1035 936 30.03 10.2418 Potri.004G059700.1.v4.1 961 862 5 1.85165 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 54.9908 6.17245 Potri.016G087400.1.v4.1 270 171 203.737 380.34 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 13 2.47905 Potri.012G127500.1.v4.1 977 878 1947 707.894 ==> SRR5423561.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 90 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 27 SRR5423561 completed mapping pipeline successfully