Starting /dee2/code/volunteer_pipeline.sh SRR5423562 current disk space = 3089953095680 free memory = 1450149916 SRR5423562 SRAfilesize 62e048c7267c553596a2b65daa3569e6 SRR5423562.sra SRR5423562.sra file validated SRR5423562 is single end SRR5423562 is conventional basespace SRR5423562 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.601 34.0 31.0 34.0 31.0 34.0 2 32.73325 34.0 31.0 34.0 31.0 34.0 3 32.8055 34.0 31.0 34.0 31.0 34.0 4 36.14625 37.0 37.0 37.0 35.0 37.0 5 36.1315 37.0 37.0 37.0 35.0 37.0 6 36.022 37.0 36.0 37.0 35.0 37.0 7 36.094 37.0 35.0 37.0 35.0 37.0 8 36.07325 37.0 36.0 37.0 35.0 37.0 9 37.84425 39.0 38.0 39.0 35.0 39.0 10 37.79575 39.0 38.0 39.0 35.0 39.0 11 37.71375 39.0 38.0 39.0 35.0 39.0 12 37.87225 39.0 38.0 39.0 35.0 39.0 13 37.79925 39.0 38.0 39.0 35.0 39.0 14 39.27575 41.0 39.0 41.0 36.0 41.0 15 39.22275 40.0 39.0 41.0 36.0 41.0 16 39.31475 41.0 39.0 41.0 36.0 41.0 17 39.194 41.0 39.0 41.0 36.0 41.0 18 39.19075 40.0 39.0 41.0 36.0 41.0 19 39.08725 40.0 39.0 41.0 36.0 41.0 20 39.13775 40.0 39.0 41.0 36.0 41.0 21 39.096 40.0 39.0 41.0 36.0 41.0 22 39.08725 40.0 39.0 41.0 36.0 41.0 23 39.08575 40.0 39.0 41.0 36.0 41.0 24 39.046 40.0 39.0 41.0 36.0 41.0 25 39.1225 40.0 39.0 41.0 36.0 41.0 26 39.09125 40.0 39.0 41.0 36.0 41.0 27 38.755 40.0 38.0 41.0 35.0 41.0 28 38.8795 40.0 39.0 41.0 35.0 41.0 29 38.9135 40.0 39.0 41.0 35.0 41.0 30 38.82 40.0 38.0 41.0 35.0 41.0 31 38.786 40.0 39.0 41.0 35.0 41.0 32 38.7665 40.0 38.0 41.0 35.0 41.0 33 38.741 40.0 38.0 41.0 35.0 41.0 34 38.7785 40.0 38.0 41.0 35.0 41.0 35 38.7875 40.0 38.0 41.0 35.0 41.0 36 38.56375 40.0 38.0 41.0 34.0 41.0 37 38.6195 40.0 38.0 41.0 35.0 41.0 38 38.521 40.0 38.0 41.0 34.0 41.0 39 38.44275 40.0 38.0 41.0 34.0 41.0 40 38.38175 40.0 38.0 41.0 34.0 41.0 41 38.4365 40.0 38.0 41.0 34.0 41.0 42 38.33625 40.0 38.0 41.0 33.0 41.0 43 38.36675 40.0 38.0 41.0 34.0 41.0 44 38.28125 40.0 38.0 41.0 34.0 41.0 45 38.18375 40.0 38.0 41.0 33.0 41.0 46 38.1675 40.0 38.0 41.0 33.0 41.0 47 38.02825 40.0 38.0 41.0 33.0 41.0 48 37.9325 40.0 37.0 41.0 33.0 41.0 49 37.882 40.0 37.0 41.0 33.0 41.0 50 37.89075 40.0 37.0 41.0 33.0 41.0 51 37.6685 40.0 37.0 41.0 32.0 41.0 52 36.779 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2206 1 0.0 2206 2 0.0 2206 3 0.0 2206 4 0.0 2206 5 0.0 2206 6 0.0 2206 7 0.0 2206 8 0.0 2206 9 0.0 2206 10 0.0 2206 11 0.0 2206 12 0.0 2206 13 0.0 2206 14 0.0 2206 15 0.0 2206 16 0.0 2206 17 0.0 2206 18 0.0 2206 19 0.0 2206 20 0.0 2206 21 0.0 2206 22 0.0 2206 23 0.0 2206 24 0.0 2206 25 0.0 2206 26 0.0 2206 27 0.0 2206 28 0.0 2206 29 0.0 2206 30 0.0 2206 31 0.0 2206 32 0.0 2206 33 0.0 2206 34 0.0 2206 35 0.0 2206 36 0.0 2206 37 0.0 2206 38 0.0 2206 39 0.0 2206 40 0.0 2206 41 0.0 2206 42 0.0 2206 43 0.0 2206 44 0.0 2206 45 0.0 2206 46 0.0 2206 47 0.0 2206 48 0.0 2206 49 0.0 2206 50 0.0 2206 51 0.0 2206 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 6.0 24 7.0 25 3.0 26 8.0 27 20.0 28 32.0 29 24.0 30 41.0 31 56.0 32 66.0 33 91.0 34 120.0 35 145.0 36 215.0 37 356.0 38 716.0 39 2081.0 40 10.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.59329664832416 11.555777888944473 6.178089044522261 45.67283641820911 2 20.724999999999998 14.6 38.574999999999996 26.1 3 20.25 18.425 24.425 36.9 4 24.75 27.05 21.975 26.224999999999998 5 23.425 30.9 24.575 21.099999999999998 6 18.45 32.525 24.975 24.05 7 14.6 23.75 41.9 19.75 8 16.825000000000003 22.650000000000002 31.0 29.525000000000002 9 17.349999999999998 19.975 34.25 28.425 10 17.9 36.025 25.624999999999996 20.45 11 23.45 26.424999999999997 23.05 27.075 12 21.725 22.075 27.825 28.375 13 20.150000000000002 27.175 27.800000000000004 24.875 14 19.950000000000003 26.375 28.775000000000002 24.9 15 20.525 25.724999999999998 27.200000000000003 26.55 16 21.15 25.324999999999996 27.400000000000002 26.125 17 21.025 26.325 27.400000000000002 25.25 18 20.424999999999997 25.1 27.3 27.175 19 19.725 26.1 27.55 26.625 20 20.8 25.575 28.025 25.6 21 21.3 24.725 27.125 26.85 22 20.825 25.7 27.075 26.400000000000002 23 20.7 24.625 29.299999999999997 25.374999999999996 24 21.625 25.324999999999996 26.424999999999997 26.625 25 20.525 26.474999999999998 26.375 26.625 26 21.8 25.85 27.0 25.35 27 20.849999999999998 26.25 26.775 26.125 28 20.575 25.874999999999996 27.35 26.200000000000003 29 21.125 26.224999999999998 27.425 25.224999999999998 30 19.925 24.925 28.175 26.974999999999998 31 20.375 26.474999999999998 26.85 26.3 32 21.825 26.0 26.450000000000003 25.724999999999998 33 20.4 24.125 28.799999999999997 26.674999999999997 34 21.125 25.724999999999998 26.625 26.525 35 21.375 24.85 27.35 26.424999999999997 36 20.349999999999998 25.5 27.125 27.025 37 21.9 26.400000000000002 25.624999999999996 26.075 38 21.025 26.900000000000002 26.400000000000002 25.674999999999997 39 19.900000000000002 25.75 28.000000000000004 26.35 40 21.275 26.0 27.500000000000004 25.224999999999998 41 21.975 24.825 26.775 26.424999999999997 42 21.25 25.624999999999996 26.900000000000002 26.224999999999998 43 21.224999999999998 25.474999999999998 25.525 27.775 44 21.125 25.074999999999996 27.025 26.775 45 21.4 25.124999999999996 26.700000000000003 26.775 46 21.325 25.224999999999998 26.1 27.35 47 21.025 25.974999999999998 26.650000000000002 26.35 48 21.9 25.25 27.474999999999998 25.374999999999996 49 21.25 25.174999999999997 26.1 27.474999999999998 50 22.1 25.85 26.150000000000002 25.900000000000002 51 20.275000000000002 24.975 27.175 27.575 52 21.575 25.124999999999996 25.724999999999998 27.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 2.0 21 3.0 22 3.0 23 3.0 24 6.5 25 10.0 26 16.0 27 22.0 28 23.5 29 25.0 30 32.0 31 39.0 32 49.0 33 59.0 34 72.5 35 86.0 36 107.0 37 128.0 38 167.0 39 215.5 40 225.0 41 261.0 42 297.0 43 321.5 44 346.0 45 369.0 46 392.0 47 402.0 48 412.0 49 410.5 50 409.0 51 378.5 52 348.0 53 323.5 54 299.0 55 253.0 56 207.0 57 195.0 58 183.0 59 141.0 60 99.0 61 85.5 62 72.0 63 57.5 64 34.5 65 26.0 66 24.5 67 23.0 68 17.5 69 12.0 70 11.0 71 10.0 72 7.5 73 5.0 74 5.5 75 6.0 76 3.5 77 1.0 78 0.5 79 0.0 80 0.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.6306760847628659 1.25 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.025227043390514632 0.125 6 0.025227043390514632 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTC 6 0.15 No Hit GTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra Read 200000 spots for SRR5423562.sra Written 200000 spots for SRR5423562.sra SRR ids: ['SRR5423562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rbt8ukz3 SRR5423562.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423562 file size 703952 SRR5423562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423562 SRR5423562_1.fastq Input file: SRR5423562_1.fastq trimmed: SRR5423562-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:10:17 2025 >> started Thu Feb 13 14:10:19 2025 >> done (1.974s) 4000000 reads processed; of these: 194 ( 0.00%) short reads filtered out after trimming by size control 301 ( 0.01%) empty reads filtered out after trimming by size control 3999505 (99.99%) reads available; of these: 49121 ( 1.23%) trimmed reads available after processing 3950384 (98.77%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 3 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 0 0.00% 27 3 0.00% 28 8 0.00% 29 4 0.00% 30 3 0.00% 31 8 0.00% 32 12 0.00% 33 24 0.00% 34 27 0.00% 35 30 0.00% 36 26 0.00% 37 29 0.00% 38 35 0.00% 39 56 0.00% 40 66 0.00% 41 58 0.00% 42 80 0.00% 43 117 0.00% 44 175 0.00% 45 210 0.01% 46 395 0.01% 47 554 0.01% 48 915 0.02% 49 1952 0.05% 50 5388 0.13% 51 38925 0.97% 52 3950384 98.77% 3999505 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=5.77 fanout-score-rank=11 prefix-density=0.41 prefix-fanout=1.6 sequence=ATCTCCTTCCAGGCCAGTGAGAGCCAGTGTGTTCTTTTCTTCATCCACTACCACCTTCTCTTTAAAGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=182.83 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=22.7 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:10:33 Started mapping on | Feb 13 14:10:33 Finished on | Feb 13 14:10:38 Mapping speed, Million of reads per hour | 2879.64 Number of input reads | 3999505 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3645193 Uniquely mapped reads % | 91.14% Average mapped length | 51.82 Number of splices: Total | 482549 Number of splices: Annotated (sjdb) | 474727 Number of splices: GT/AG | 475840 Number of splices: GC/AG | 5828 Number of splices: AT/AC | 362 Number of splices: Non-canonical | 519 Mismatch rate per base, % | 0.26% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281390 % of reads mapped to multiple loci | 7.04% Number of reads mapped to too many loci | 43549 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72922 72922 72922 N_multimapping 281390 281390 281390 N_noFeature 127329 3613408 142853 N_ambiguous 27160 75 10865 UnstrandedReadsAssigned:3490704 PositiveStrandReadsAssigned:31710 NegativeStrandReadsAssigned:3491475 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423562 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423562-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,505 reads, 3,667,829 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,132 rounds 52401 SRR5423562.ke.tsv 34699 SRR5423562.se.tsv 87100 total ==> SRR5423562.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 182.489 30.2109 Potri.005G024800.1.v4.1 1035 936 33 11.2005 Potri.004G059700.1.v4.1 961 862 5.2417 1.93182 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 70.1233 7.8331 Potri.016G087400.1.v4.1 270 171 190 352.987 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 19.8562 3.76827 Potri.012G127500.1.v4.1 977 878 2035 736.327 ==> SRR5423562.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR5423562 completed mapping pipeline successfully