Starting /dee2/code/volunteer_pipeline.sh SRR5423563 current disk space = 3089832833024 free memory = 1492763332 SRR5423563 SRAfilesize e7cd0a63fa6ff1a6607f465c7fb717c4 SRR5423563.sra SRR5423563.sra file validated SRR5423563 is single end SRR5423563 is conventional basespace SRR5423563 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.4775 31.0 31.0 34.0 28.0 34.0 2 31.773 31.0 31.0 34.0 30.0 34.0 3 32.006 33.0 31.0 34.0 30.0 34.0 4 32.1845 35.0 32.0 37.0 19.0 37.0 5 34.6045 37.0 35.0 37.0 30.0 37.0 6 35.2815 37.0 35.0 37.0 32.0 37.0 7 35.56475 37.0 35.0 37.0 33.0 37.0 8 35.58125 37.0 35.0 37.0 33.0 37.0 9 37.25025 39.0 37.0 39.0 34.0 39.0 10 37.163 39.0 37.0 39.0 33.0 39.0 11 37.11625 39.0 37.0 39.0 33.0 39.0 12 37.229 39.0 37.0 39.0 34.0 39.0 13 37.283 39.0 37.0 39.0 34.0 39.0 14 38.5905 40.0 38.0 41.0 34.0 41.0 15 38.55875 40.0 38.0 41.0 34.0 41.0 16 38.355 40.0 38.0 41.0 33.0 41.0 17 38.505 40.0 38.0 41.0 34.0 41.0 18 38.549 40.0 38.0 41.0 34.0 41.0 19 38.49575 40.0 38.0 41.0 34.0 41.0 20 38.27725 40.0 38.0 41.0 33.0 41.0 21 38.35375 40.0 38.0 41.0 34.0 41.0 22 38.41625 40.0 38.0 41.0 34.0 41.0 23 38.21725 40.0 38.0 41.0 33.0 41.0 24 38.4115 40.0 38.0 41.0 34.0 41.0 25 38.2955 40.0 38.0 41.0 33.0 41.0 26 38.32525 40.0 38.0 41.0 34.0 41.0 27 38.327 40.0 38.0 41.0 34.0 41.0 28 38.37775 40.0 38.0 41.0 34.0 41.0 29 38.36575 40.0 38.0 41.0 34.0 41.0 30 38.173 40.0 38.0 41.0 34.0 41.0 31 38.35325 40.0 38.0 41.0 34.0 41.0 32 38.22225 40.0 38.0 41.0 34.0 41.0 33 38.246 40.0 38.0 41.0 34.0 41.0 34 38.266 40.0 38.0 41.0 34.0 41.0 35 38.131 40.0 38.0 41.0 33.0 41.0 36 38.09975 40.0 38.0 41.0 33.0 41.0 37 38.2095 40.0 38.0 41.0 33.0 41.0 38 38.0765 40.0 38.0 41.0 33.0 41.0 39 38.02825 40.0 37.0 41.0 33.0 41.0 40 38.02025 40.0 37.0 41.0 33.0 41.0 41 37.86375 40.0 37.0 41.0 33.0 41.0 42 37.8435 40.0 37.0 41.0 33.0 41.0 43 37.9555 40.0 37.0 41.0 33.0 41.0 44 37.69625 40.0 37.0 41.0 32.0 41.0 45 37.82475 40.0 37.0 41.0 33.0 41.0 46 37.68775 40.0 37.0 41.0 32.0 41.0 47 37.5185 40.0 37.0 41.0 32.0 41.0 48 37.56675 40.0 37.0 41.0 32.0 41.0 49 37.6805 40.0 37.0 41.0 33.0 41.0 50 37.57225 40.0 37.0 41.0 32.0 41.0 51 37.41125 40.0 36.0 41.0 31.0 41.0 52 36.81275 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.0 23 1.0 24 4.0 25 9.0 26 8.0 27 22.0 28 31.0 29 52.0 30 63.0 31 85.0 32 101.0 33 124.0 34 168.0 35 232.0 36 338.0 37 478.0 38 812.0 39 1453.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.39369684842421 11.880940470235117 5.977988994497249 44.747373686843424 2 21.45 15.725 36.875 25.95 3 20.7 18.775 24.7 35.825 4 23.825 26.0 24.25 25.924999999999997 5 23.275000000000002 31.674999999999997 24.15 20.9 6 17.775 33.225 24.925 24.075 7 14.124999999999998 23.325000000000003 43.45 19.1 8 17.025000000000002 22.25 32.074999999999996 28.65 9 16.825000000000003 22.3 33.15 27.725 10 18.0 37.35 24.224999999999998 20.424999999999997 11 23.549999999999997 26.575 22.900000000000002 26.974999999999998 12 21.0 23.724999999999998 26.025 29.25 13 19.400000000000002 27.075 27.250000000000004 26.275 14 19.275000000000002 26.174999999999997 28.549999999999997 26.0 15 20.1 25.5 26.8 27.6 16 22.05 26.700000000000003 27.0 24.25 17 21.625 25.1 26.900000000000002 26.375 18 19.475 25.224999999999998 28.325 26.974999999999998 19 21.9 26.35 26.55 25.2 20 20.875 25.8 26.974999999999998 26.35 21 20.349999999999998 26.3 27.35 26.0 22 21.6 25.95 27.075 25.374999999999996 23 19.900000000000002 24.95 28.1 27.05 24 19.975 25.7 27.425 26.900000000000002 25 20.125 26.075 26.650000000000002 27.150000000000002 26 19.650000000000002 26.775 27.325 26.25 27 19.950000000000003 25.05 27.3 27.700000000000003 28 20.8 26.025 27.425 25.75 29 20.125 24.8 27.900000000000002 27.175 30 19.400000000000002 26.75 27.05 26.8 31 20.575 26.900000000000002 26.724999999999998 25.8 32 20.1 25.775 27.55 26.575 33 21.575 24.85 27.150000000000002 26.424999999999997 34 22.45 24.875 24.95 27.725 35 20.200000000000003 25.324999999999996 27.800000000000004 26.674999999999997 36 20.775 24.875 27.375 26.974999999999998 37 21.975 25.45 26.974999999999998 25.6 38 21.525 25.85 26.650000000000002 25.974999999999998 39 20.974999999999998 25.2 26.650000000000002 27.175 40 21.2 26.3 27.500000000000004 25.0 41 22.400000000000002 24.525 27.0 26.075 42 20.575 25.624999999999996 26.275 27.525 43 22.45 25.25 27.800000000000004 24.5 44 20.75 25.15 27.825 26.275 45 19.3 25.0 26.825 28.875 46 20.175 25.650000000000002 27.125 27.05 47 21.775 25.25 27.325 25.650000000000002 48 19.675 25.974999999999998 27.825 26.525 49 21.45 25.45 26.825 26.275 50 21.375 25.0 27.1 26.525 51 20.4 25.2 27.1 27.3 52 20.925 26.125 27.55 25.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.5 21 3.0 22 3.5 23 4.0 24 9.5 25 15.0 26 17.5 27 20.0 28 22.5 29 25.0 30 36.5 31 48.0 32 58.0 33 68.0 34 88.5 35 109.0 36 125.0 37 141.0 38 165.0 39 205.0 40 221.0 41 256.5 42 292.0 43 322.5 44 353.0 45 367.5 46 382.0 47 396.5 48 411.0 49 393.0 50 375.0 51 357.0 52 339.0 53 321.5 54 304.0 55 272.5 56 241.0 57 203.0 58 165.0 59 142.5 60 120.0 61 93.5 62 67.0 63 51.0 64 31.0 65 27.0 66 23.0 67 19.0 68 16.0 69 13.0 70 10.0 71 7.0 72 5.0 73 3.0 74 2.5 75 2.0 76 1.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26749179085628 98.25 2 0.5809547865622632 1.15 3 0.050517807527153326 0.15 4 0.07577671129072998 0.3 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTCTCATCATCGAAGGAAACCTCCTCTTTAAAGACCCCGGCTTTCCCTCCG 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra Read 200000 spots for SRR5423563.sra Written 200000 spots for SRR5423563.sra SRR ids: ['SRR5423563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_os0i2xh2 SRR5423563.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423563 file size 704001 SRR5423563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423563 SRR5423563_1.fastq Input file: SRR5423563_1.fastq trimmed: SRR5423563-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:23:27 2025 >> started Thu Feb 13 14:23:29 2025 >> done (1.963s) 4000000 reads processed; of these: 182 ( 0.00%) short reads filtered out after trimming by size control 254 ( 0.01%) empty reads filtered out after trimming by size control 3999564 (99.99%) reads available; of these: 52773 ( 1.32%) trimmed reads available after processing 3946791 (98.68%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 5 0.00% 20 9 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 6 0.00% 27 5 0.00% 28 12 0.00% 29 8 0.00% 30 13 0.00% 31 11 0.00% 32 13 0.00% 33 34 0.00% 34 22 0.00% 35 25 0.00% 36 32 0.00% 37 53 0.00% 38 50 0.00% 39 66 0.00% 40 83 0.00% 41 66 0.00% 42 114 0.00% 43 154 0.00% 44 210 0.01% 45 314 0.01% 46 440 0.01% 47 632 0.02% 48 1056 0.03% 49 2192 0.05% 50 6206 0.16% 51 40923 1.02% 52 3946791 98.68% 3999564 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=10 fanout-score=172.65 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.9 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:23:44 Started mapping on | Feb 13 14:23:45 Finished on | Feb 13 14:23:50 Mapping speed, Million of reads per hour | 2879.69 Number of input reads | 3999564 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3645115 Uniquely mapped reads % | 91.14% Average mapped length | 51.82 Number of splices: Total | 482009 Number of splices: Annotated (sjdb) | 474259 Number of splices: GT/AG | 475386 Number of splices: GC/AG | 5752 Number of splices: AT/AC | 342 Number of splices: Non-canonical | 529 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.63 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 281658 % of reads mapped to multiple loci | 7.04% Number of reads mapped to too many loci | 42872 % of reads mapped to too many loci | 1.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.74% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72791 72791 72791 N_multimapping 281658 281658 281658 N_noFeature 126821 3613404 142422 N_ambiguous 27014 54 10880 UnstrandedReadsAssigned:3491280 PositiveStrandReadsAssigned:31657 NegativeStrandReadsAssigned:3491813 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423563 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423563-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,564 reads, 3,669,747 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,172 rounds 52401 SRR5423563.ke.tsv 34699 SRR5423563.se.tsv 87100 total ==> SRR5423563.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 175 28.9764 Potri.005G024800.1.v4.1 1035 936 28.0097 9.50856 Potri.004G059700.1.v4.1 961 862 5.28483 1.94808 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.3553 7.74875 Potri.016G087400.1.v4.1 270 171 201 373.493 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 16.5837 3.14781 Potri.012G127500.1.v4.1 977 878 1956 707.875 ==> SRR5423563.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 88 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 21 SRR5423563 completed mapping pipeline successfully