Starting /dee2/code/volunteer_pipeline.sh SRR5423564 current disk space = 3089849360384 free memory = 1460066696 SRR5423564 SRAfilesize 31188afc7dfbb99283970e8be27becb3 SRR5423564.sra SRR5423564.sra file validated SRR5423564 is single end SRR5423564 is conventional basespace SRR5423564 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423564_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.6345 34.0 31.0 34.0 28.0 34.0 2 31.741 34.0 31.0 34.0 28.0 34.0 3 32.5855 34.0 31.0 34.0 30.0 34.0 4 36.11725 37.0 35.0 37.0 35.0 37.0 5 36.046 37.0 35.0 37.0 35.0 37.0 6 36.25625 37.0 37.0 37.0 35.0 37.0 7 36.2895 37.0 37.0 37.0 35.0 37.0 8 36.22325 37.0 37.0 37.0 35.0 37.0 9 37.9795 39.0 38.0 39.0 35.0 39.0 10 38.01475 39.0 38.0 39.0 35.0 39.0 11 38.09025 39.0 38.0 39.0 35.0 39.0 12 38.0155 39.0 38.0 39.0 35.0 39.0 13 37.9365 39.0 38.0 39.0 35.0 39.0 14 39.50175 41.0 39.0 41.0 36.0 41.0 15 39.4295 41.0 39.0 41.0 37.0 41.0 16 39.42775 41.0 39.0 41.0 36.0 41.0 17 39.34425 41.0 39.0 41.0 36.0 41.0 18 39.37675 41.0 39.0 41.0 36.0 41.0 19 39.43825 41.0 39.0 41.0 37.0 41.0 20 39.3775 41.0 39.0 41.0 36.0 41.0 21 39.35075 41.0 39.0 41.0 36.0 41.0 22 39.42675 41.0 39.0 41.0 37.0 41.0 23 39.32575 41.0 39.0 41.0 36.0 41.0 24 39.29275 41.0 39.0 41.0 36.0 41.0 25 39.30075 41.0 39.0 41.0 36.0 41.0 26 39.26325 41.0 39.0 41.0 36.0 41.0 27 39.21275 41.0 39.0 41.0 36.0 41.0 28 39.06475 41.0 39.0 41.0 36.0 41.0 29 39.134 41.0 39.0 41.0 36.0 41.0 30 39.02975 41.0 39.0 41.0 36.0 41.0 31 38.994 41.0 39.0 41.0 36.0 41.0 32 38.92675 40.0 39.0 41.0 35.0 41.0 33 38.8855 40.0 39.0 41.0 35.0 41.0 34 38.96325 40.0 39.0 41.0 35.0 41.0 35 38.8605 40.0 39.0 41.0 35.0 41.0 36 38.74 40.0 38.0 41.0 35.0 41.0 37 38.7285 40.0 38.0 41.0 35.0 41.0 38 38.7225 40.0 38.0 41.0 35.0 41.0 39 38.62075 40.0 38.0 41.0 35.0 41.0 40 38.471 40.0 38.0 41.0 34.0 41.0 41 38.47425 40.0 38.0 41.0 34.0 41.0 42 38.40075 40.0 38.0 41.0 34.0 41.0 43 38.3585 40.0 38.0 41.0 34.0 41.0 44 38.228 40.0 38.0 41.0 34.0 41.0 45 38.07 40.0 38.0 41.0 33.0 41.0 46 38.1105 40.0 38.0 41.0 33.0 41.0 47 37.9945 40.0 38.0 41.0 33.0 41.0 48 38.0 40.0 38.0 41.0 33.0 41.0 49 37.977 40.0 38.0 41.0 33.0 41.0 50 37.86175 40.0 37.0 41.0 33.0 41.0 51 37.83025 40.0 37.0 41.0 33.0 41.0 52 36.22325 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 0.0 21 1.0 22 2.0 23 8.0 24 4.0 25 13.0 26 9.0 27 14.0 28 24.0 29 26.0 30 36.0 31 45.0 32 54.0 33 73.0 34 107.0 35 145.0 36 243.0 37 369.0 38 744.0 39 2068.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.1157469717362 11.251682368775235 6.594885598923284 44.03768506056527 2 22.5 15.15 36.225 26.125 3 21.7 17.8 24.15 36.35 4 24.9 25.55 22.25 27.3 5 24.8 30.45 24.25 20.5 6 18.9 32.2 24.975 23.925 7 14.45 23.549999999999997 42.675000000000004 19.325 8 17.1 21.55 33.475 27.875 9 17.974999999999998 20.974999999999998 34.225 26.825 10 19.675 35.699999999999996 24.75 19.875 11 22.875 25.4 23.175 28.549999999999997 12 21.099999999999998 22.75 27.6 28.549999999999997 13 20.375 25.35 29.275000000000002 25.0 14 19.425 26.875 28.849999999999998 24.85 15 19.525000000000002 25.775 27.950000000000003 26.75 16 20.724999999999998 25.174999999999997 27.525 26.575 17 21.325 26.924999999999997 26.125 25.624999999999996 18 21.525 25.825 26.775 25.874999999999996 19 20.8 27.525 25.6 26.075 20 21.025 26.525 27.450000000000003 25.0 21 19.15 26.275 27.375 27.200000000000003 22 21.625 25.174999999999997 26.875 26.325 23 21.099999999999998 25.825 28.075 25.0 24 21.8 24.375 27.250000000000004 26.575 25 19.875 25.75 27.375 27.0 26 20.724999999999998 24.825 28.325 26.125 27 21.4 25.45 27.6 25.55 28 20.95 25.624999999999996 27.500000000000004 25.924999999999997 29 21.4 26.35 27.075 25.174999999999997 30 20.4 25.25 26.775 27.575 31 21.125 26.424999999999997 27.150000000000002 25.3 32 21.825 24.65 27.075 26.450000000000003 33 20.7 25.15 26.825 27.325 34 21.2 25.85 26.55 26.400000000000002 35 20.4 26.400000000000002 27.450000000000003 25.75 36 21.875 25.25 26.450000000000003 26.424999999999997 37 20.7 26.325 26.55 26.424999999999997 38 21.625 24.825 27.55 26.0 39 21.575 24.349999999999998 26.125 27.950000000000003 40 21.099999999999998 25.85 27.150000000000002 25.900000000000002 41 21.475 25.224999999999998 26.875 26.424999999999997 42 20.65 25.525 27.750000000000004 26.075 43 20.7 26.55 27.200000000000003 25.55 44 21.525 24.7 26.924999999999997 26.85 45 20.150000000000002 26.275 25.974999999999998 27.6 46 20.599999999999998 26.1 27.500000000000004 25.8 47 22.425 25.874999999999996 25.8 25.900000000000002 48 20.674999999999997 25.05 27.575 26.700000000000003 49 21.7 24.025 27.725 26.55 50 21.9 23.65 27.1 27.35 51 20.05 25.174999999999997 27.6 27.175 52 20.825 25.5 26.924999999999997 26.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 2.0 19 4.0 20 4.0 21 4.0 22 6.0 23 8.0 24 11.0 25 14.0 26 15.5 27 17.0 28 19.5 29 22.0 30 23.5 31 25.0 32 46.0 33 67.0 34 86.0 35 105.0 36 120.5 37 136.0 38 176.0 39 223.0 40 230.0 41 264.5 42 299.0 43 315.0 44 331.0 45 352.5 46 374.0 47 400.0 48 426.0 49 407.0 50 388.0 51 371.5 52 355.0 53 319.0 54 283.0 55 252.0 56 221.0 57 186.0 58 151.0 59 129.5 60 108.0 61 91.0 62 74.0 63 60.5 64 40.5 65 34.0 66 30.5 67 27.0 68 19.0 69 11.0 70 11.0 71 11.0 72 8.5 73 6.0 74 4.0 75 2.0 76 2.0 77 2.0 78 1.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.124999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra Read 200000 spots for SRR5423564.sra Written 200000 spots for SRR5423564.sra SRR ids: ['SRR5423564.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pq_xy6xv SRR5423564.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423564 file size 703974 SRR5423564 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423564 SRR5423564_1.fastq Input file: SRR5423564_1.fastq trimmed: SRR5423564-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:23:01 2025 >> started Thu Feb 13 14:23:02 2025 >> done (1.706s) 4000000 reads processed; of these: 276 ( 0.01%) short reads filtered out after trimming by size control 413 ( 0.01%) empty reads filtered out after trimming by size control 3999311 (99.98%) reads available; of these: 54436 ( 1.36%) trimmed reads available after processing 3944875 (98.64%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 20 0.00% 20 13 0.00% 21 0 0.00% 22 2 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 4 0.00% 27 5 0.00% 28 4 0.00% 29 3 0.00% 30 3 0.00% 31 9 0.00% 32 21 0.00% 33 18 0.00% 34 25 0.00% 35 29 0.00% 36 29 0.00% 37 37 0.00% 38 48 0.00% 39 59 0.00% 40 62 0.00% 41 89 0.00% 42 103 0.00% 43 149 0.00% 44 200 0.01% 45 240 0.01% 46 365 0.01% 47 516 0.01% 48 917 0.02% 49 2012 0.05% 50 5762 0.14% 51 43677 1.09% 52 3944875 98.64% 3999311 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=12 fanout-score=169.88 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=22.0 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:23:15 Started mapping on | Feb 13 14:23:15 Finished on | Feb 13 14:23:20 Mapping speed, Million of reads per hour | 2879.50 Number of input reads | 3999311 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3661697 Uniquely mapped reads % | 91.56% Average mapped length | 51.82 Number of splices: Total | 485950 Number of splices: Annotated (sjdb) | 478078 Number of splices: GT/AG | 479461 Number of splices: GC/AG | 5648 Number of splices: AT/AC | 325 Number of splices: Non-canonical | 516 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265129 % of reads mapped to multiple loci | 6.63% Number of reads mapped to too many loci | 43424 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72485 72485 72485 N_multimapping 265129 265129 265129 N_noFeature 128737 3629549 143067 N_ambiguous 28897 46 11062 UnstrandedReadsAssigned:3504063 PositiveStrandReadsAssigned:32102 NegativeStrandReadsAssigned:3507568 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423564 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423564-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,311 reads, 3,671,962 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR5423564.ke.tsv 34699 SRR5423564.se.tsv 87100 total ==> SRR5423564.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 151 24.9243 Potri.005G024800.1.v4.1 1035 936 32 10.8292 Potri.004G059700.1.v4.1 961 862 13 4.77703 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 78.8786 8.78519 Potri.016G087400.1.v4.1 270 171 167 309.344 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8.38622 1.58684 Potri.012G127500.1.v4.1 977 878 1861 671.388 ==> SRR5423564.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 107 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR5423564 completed mapping pipeline successfully