Starting /dee2/code/volunteer_pipeline.sh SRR5423565 current disk space = 3089944821760 free memory = 1450031356 SRR5423565 SRAfilesize 939765895b9ce2c53e78d5bd86daf969 SRR5423565.sra SRR5423565.sra file validated SRR5423565 is single end SRR5423565 is conventional basespace SRR5423565 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423565_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.79725 33.0 31.0 34.0 30.0 34.0 2 32.13075 34.0 31.0 34.0 30.0 34.0 3 32.2215 34.0 31.0 34.0 30.0 34.0 4 34.3345 37.0 35.0 37.0 28.0 37.0 5 35.28775 37.0 35.0 37.0 32.0 37.0 6 35.466 37.0 35.0 37.0 33.0 37.0 7 35.712 37.0 35.0 37.0 33.0 37.0 8 35.8 37.0 35.0 37.0 35.0 37.0 9 37.53325 39.0 37.0 39.0 35.0 39.0 10 37.51275 39.0 37.0 39.0 35.0 39.0 11 37.4845 39.0 37.0 39.0 35.0 39.0 12 37.32475 39.0 37.0 39.0 34.0 39.0 13 37.39775 39.0 37.0 39.0 34.0 39.0 14 38.68275 40.0 38.0 41.0 34.0 41.0 15 38.719 40.0 38.0 41.0 34.0 41.0 16 38.6935 40.0 38.0 41.0 34.0 41.0 17 38.47875 40.0 38.0 41.0 33.0 41.0 18 38.43825 40.0 38.0 41.0 34.0 41.0 19 38.5765 40.0 38.0 41.0 34.0 41.0 20 38.662 40.0 38.0 41.0 34.0 41.0 21 38.496 40.0 38.0 41.0 34.0 41.0 22 38.58475 40.0 38.0 41.0 34.0 41.0 23 38.513 40.0 38.0 41.0 34.0 41.0 24 38.527 40.0 38.0 41.0 34.0 41.0 25 38.663 40.0 38.0 41.0 34.0 41.0 26 38.6325 40.0 38.0 41.0 34.0 41.0 27 38.573 40.0 38.0 41.0 34.0 41.0 28 38.5225 40.0 38.0 41.0 34.0 41.0 29 38.3385 40.0 38.0 41.0 34.0 41.0 30 38.52725 40.0 38.0 41.0 34.0 41.0 31 38.53025 40.0 38.0 41.0 34.0 41.0 32 38.38825 40.0 38.0 41.0 34.0 41.0 33 38.1675 40.0 38.0 41.0 33.0 41.0 34 38.206 40.0 38.0 41.0 33.0 41.0 35 38.04425 40.0 38.0 41.0 33.0 41.0 36 37.4825 40.0 37.0 41.0 31.0 41.0 37 38.0555 40.0 38.0 41.0 33.0 41.0 38 38.06125 40.0 38.0 41.0 33.0 41.0 39 38.0995 40.0 38.0 41.0 33.0 41.0 40 38.028 40.0 37.0 41.0 33.0 41.0 41 38.117 40.0 37.0 41.0 33.0 41.0 42 38.03275 40.0 37.0 41.0 33.0 41.0 43 37.9305 40.0 37.0 41.0 33.0 41.0 44 37.73625 40.0 37.0 41.0 33.0 41.0 45 37.77775 40.0 37.0 41.0 33.0 41.0 46 37.85925 40.0 37.0 41.0 33.0 41.0 47 37.81425 40.0 37.0 41.0 33.0 41.0 48 37.7575 40.0 37.0 41.0 33.0 41.0 49 37.7655 40.0 37.0 41.0 33.0 41.0 50 37.51125 40.0 37.0 41.0 32.0 41.0 51 37.6875 40.0 37.0 41.0 32.0 41.0 52 36.835 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1114 1 0.0 1114 2 0.0 1114 3 0.0 1114 4 0.0 1114 5 0.0 1114 6 0.0 1114 7 0.0 1114 8 0.0 1114 9 0.0 1114 10 0.0 1114 11 0.0 1114 12 0.0 1114 13 0.0 1114 14 0.0 1114 15 0.0 1114 16 0.0 1114 17 0.0 1114 18 0.0 1114 19 0.0 1114 20 0.0 1114 21 0.0 1114 22 0.0 1114 23 0.0 1114 24 0.0 1114 25 0.0 1114 26 0.0 1114 27 0.0 1114 28 0.0 1114 29 0.0 1114 30 0.0 1114 31 0.0 1114 32 0.0 1114 33 0.0 1114 34 0.0 1114 35 0.0 1114 36 0.0 1114 37 0.0 1114 38 0.0 1114 39 0.0 1114 40 0.0 1114 41 0.0 1114 42 0.0 1114 43 0.0 1114 44 0.0 1114 45 0.0 1114 46 0.0 1114 47 0.0 1114 48 0.0 1114 49 0.0 1114 50 0.0 1114 51 0.0 1114 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 5.0 24 5.0 25 6.0 26 12.0 27 25.0 28 31.0 29 39.0 30 76.0 31 66.0 32 83.0 33 119.0 34 171.0 35 202.0 36 303.0 37 460.0 38 711.0 39 1678.0 40 5.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.11074918566775 10.924580305687797 6.8654472563267355 44.099223252317714 2 23.1 15.25 36.95 24.7 3 22.15 17.875 24.775 35.199999999999996 4 24.175 26.650000000000002 21.775 27.400000000000002 5 23.974999999999998 31.85 23.825 20.349999999999998 6 19.825 32.975 24.075 23.125 7 14.524999999999999 23.225 42.6 19.650000000000002 8 17.849999999999998 22.375 31.15 28.625 9 17.65 20.549999999999997 33.775 28.025 10 18.75 36.275 25.275 19.7 11 23.200000000000003 28.525 21.275 27.0 12 20.674999999999997 22.975 28.299999999999997 28.050000000000004 13 19.6 25.674999999999997 29.65 25.074999999999996 14 19.85 25.474999999999998 29.575000000000003 25.1 15 21.575 25.124999999999996 27.474999999999998 25.825 16 20.549999999999997 26.450000000000003 26.825 26.174999999999997 17 21.275 25.85 28.449999999999996 24.425 18 20.349999999999998 25.85 28.425 25.374999999999996 19 20.849999999999998 26.8 27.125 25.224999999999998 20 20.925 26.25 28.299999999999997 24.525 21 20.65 25.775 27.575 26.0 22 20.525 26.075 28.000000000000004 25.4 23 20.724999999999998 25.374999999999996 27.775 26.125 24 20.75 26.974999999999998 25.974999999999998 26.3 25 21.175 25.85 26.35 26.625 26 21.85 25.1 26.900000000000002 26.150000000000002 27 20.7 25.874999999999996 26.224999999999998 27.200000000000003 28 21.05 26.0 26.474999999999998 26.474999999999998 29 20.474999999999998 25.224999999999998 27.825 26.474999999999998 30 21.025 25.525 27.6 25.85 31 20.674999999999997 25.8 27.500000000000004 26.025 32 20.875 25.15 28.15 25.825 33 20.075000000000003 25.55 27.575 26.8 34 19.6 26.875 26.724999999999998 26.8 35 21.075 24.725 26.8 27.400000000000002 36 20.849999999999998 26.900000000000002 26.55 25.7 37 20.525 25.650000000000002 26.775 27.05 38 19.900000000000002 26.125 28.625 25.35 39 20.125 25.224999999999998 27.725 26.924999999999997 40 20.65 25.75 25.900000000000002 27.700000000000003 41 20.3 26.275 26.724999999999998 26.700000000000003 42 20.849999999999998 25.7 26.55 26.900000000000002 43 21.099999999999998 26.224999999999998 26.200000000000003 26.474999999999998 44 20.525 25.6 28.025 25.85 45 20.849999999999998 25.224999999999998 27.900000000000002 26.025 46 20.7 25.1 27.3 26.900000000000002 47 21.725 24.875 26.974999999999998 26.424999999999997 48 20.7 25.2 27.3 26.8 49 20.724999999999998 25.674999999999997 27.85 25.75 50 21.95 24.7 27.800000000000004 25.55 51 20.724999999999998 25.5 27.6 26.174999999999997 52 21.125 26.650000000000002 26.650000000000002 25.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 3.5 17 7.0 18 5.0 19 3.0 20 4.0 21 5.0 22 7.0 23 9.0 24 7.0 25 5.0 26 10.5 27 16.0 28 23.5 29 31.0 30 38.0 31 45.0 32 64.5 33 84.0 34 94.5 35 105.0 36 119.5 37 134.0 38 180.0 39 230.5 40 235.0 41 262.0 42 289.0 43 319.5 44 350.0 45 353.0 46 356.0 47 367.0 48 378.0 49 379.5 50 381.0 51 368.5 52 356.0 53 328.0 54 300.0 55 255.5 56 211.0 57 191.0 58 171.0 59 137.5 60 104.0 61 84.0 62 64.0 63 58.5 64 38.5 65 24.0 66 24.5 67 25.0 68 19.0 69 13.0 70 9.5 71 6.0 72 5.0 73 4.0 74 5.0 75 6.0 76 4.0 77 2.0 78 1.0 79 0.0 80 0.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3198992443325 98.575 2 0.6045340050377833 1.2 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra Read 200000 spots for SRR5423565.sra Written 200000 spots for SRR5423565.sra SRR ids: ['SRR5423565.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ekooifo4 SRR5423565.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423565 file size 703983 SRR5423565 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423565 SRR5423565_1.fastq Input file: SRR5423565_1.fastq trimmed: SRR5423565-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:19:17 2025 >> started Thu Feb 13 14:19:19 2025 >> done (2.637s) 4000000 reads processed; of these: 286 ( 0.01%) short reads filtered out after trimming by size control 414 ( 0.01%) empty reads filtered out after trimming by size control 3999300 (99.98%) reads available; of these: 56162 ( 1.40%) trimmed reads available after processing 3943138 (98.60%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 16 0.00% 20 9 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 0 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 3 0.00% 29 6 0.00% 30 12 0.00% 31 14 0.00% 32 13 0.00% 33 18 0.00% 34 14 0.00% 35 18 0.00% 36 30 0.00% 37 36 0.00% 38 40 0.00% 39 52 0.00% 40 84 0.00% 41 98 0.00% 42 90 0.00% 43 156 0.00% 44 197 0.00% 45 266 0.01% 46 367 0.01% 47 657 0.02% 48 1058 0.03% 49 2138 0.05% 50 6401 0.16% 51 44344 1.11% 52 3943138 98.60% 3999300 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=221.20 fanout-score-rank=1 prefix-density=0.51 prefix-fanout=23.0 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:19:33 Started mapping on | Feb 13 14:19:33 Finished on | Feb 13 14:19:38 Mapping speed, Million of reads per hour | 2879.50 Number of input reads | 3999300 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3663191 Uniquely mapped reads % | 91.60% Average mapped length | 51.82 Number of splices: Total | 486357 Number of splices: Annotated (sjdb) | 478349 Number of splices: GT/AG | 479799 Number of splices: GC/AG | 5647 Number of splices: AT/AC | 361 Number of splices: Non-canonical | 550 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 263721 % of reads mapped to multiple loci | 6.59% Number of reads mapped to too many loci | 43555 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72388 72388 72388 N_multimapping 263721 263721 263721 N_noFeature 128486 3631387 142742 N_ambiguous 28726 57 11159 UnstrandedReadsAssigned:3505979 PositiveStrandReadsAssigned:31747 NegativeStrandReadsAssigned:3509290 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423565 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423565-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,300 reads, 3,674,284 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,116 rounds 52401 SRR5423565.ke.tsv 34699 SRR5423565.se.tsv 87100 total ==> SRR5423565.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 183 30.2334 Potri.005G024800.1.v4.1 1035 936 20 6.7743 Potri.004G059700.1.v4.1 961 862 11 4.04572 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.3277 7.72837 Potri.016G087400.1.v4.1 270 171 181 335.578 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 18.411 3.48684 Potri.012G127500.1.v4.1 977 878 1826 659.351 ==> SRR5423565.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 106 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 30 SRR5423565 completed mapping pipeline successfully