Starting /dee2/code/volunteer_pipeline.sh SRR5423566 current disk space = 3089606332416 free memory = 1480487812 SRR5423566 SRAfilesize 91387141683e3fef443914e7f940b617 SRR5423566.sra SRR5423566.sra file validated SRR5423566 is single end SRR5423566 is conventional basespace SRR5423566 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423566_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.13975 34.0 31.0 34.0 30.0 34.0 2 32.37975 34.0 31.0 34.0 30.0 34.0 3 32.39675 34.0 31.0 34.0 30.0 34.0 4 35.436 37.0 35.0 37.0 33.0 37.0 5 35.86325 37.0 35.0 37.0 33.0 37.0 6 35.85625 37.0 35.0 37.0 35.0 37.0 7 35.889 37.0 35.0 37.0 35.0 37.0 8 35.88525 37.0 35.0 37.0 35.0 37.0 9 37.68175 39.0 37.0 39.0 35.0 39.0 10 37.4895 39.0 37.0 39.0 35.0 39.0 11 37.58025 39.0 37.0 39.0 35.0 39.0 12 37.7215 39.0 37.0 39.0 35.0 39.0 13 37.6705 39.0 37.0 39.0 35.0 39.0 14 38.95125 40.0 38.0 41.0 35.0 41.0 15 38.7865 40.0 38.0 41.0 34.0 41.0 16 38.74125 40.0 38.0 41.0 35.0 41.0 17 38.8355 40.0 38.0 41.0 35.0 41.0 18 38.76775 40.0 38.0 41.0 35.0 41.0 19 38.831 40.0 38.0 41.0 34.0 41.0 20 38.848 40.0 38.0 41.0 35.0 41.0 21 38.8185 40.0 38.0 41.0 35.0 41.0 22 38.69975 40.0 38.0 41.0 34.0 41.0 23 38.7995 40.0 38.0 41.0 34.0 41.0 24 38.83325 40.0 38.0 41.0 35.0 41.0 25 38.83975 40.0 38.0 41.0 35.0 41.0 26 38.8665 40.0 38.0 41.0 35.0 41.0 27 38.74825 40.0 38.0 41.0 35.0 41.0 28 38.71325 40.0 38.0 41.0 35.0 41.0 29 38.6805 40.0 38.0 41.0 34.0 41.0 30 38.4905 40.0 38.0 41.0 34.0 41.0 31 38.65125 40.0 38.0 41.0 34.0 41.0 32 38.7155 40.0 38.0 41.0 35.0 41.0 33 38.6535 40.0 38.0 41.0 34.0 41.0 34 38.4495 40.0 38.0 41.0 34.0 41.0 35 38.6265 40.0 38.0 41.0 34.0 41.0 36 38.5985 40.0 38.0 41.0 34.0 41.0 37 38.47 40.0 38.0 41.0 34.0 41.0 38 38.44325 40.0 38.0 41.0 34.0 41.0 39 38.378 40.0 38.0 41.0 34.0 41.0 40 38.34925 40.0 38.0 41.0 34.0 41.0 41 38.2235 40.0 38.0 41.0 33.0 41.0 42 38.192 40.0 38.0 41.0 33.0 41.0 43 38.16075 40.0 38.0 41.0 33.0 41.0 44 38.0935 40.0 38.0 41.0 33.0 41.0 45 38.012 40.0 37.0 41.0 33.0 41.0 46 38.082 40.0 37.0 41.0 33.0 41.0 47 37.87475 40.0 37.0 41.0 33.0 41.0 48 37.96575 40.0 37.0 41.0 33.0 41.0 49 37.874 40.0 37.0 41.0 33.0 41.0 50 37.71925 40.0 37.0 41.0 32.0 41.0 51 37.6455 40.0 37.0 41.0 32.0 41.0 52 36.88025 39.0 36.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1211 1 0.0 1211 2 0.0 1211 3 0.0 1211 4 0.0 1211 5 0.0 1211 6 0.0 1211 7 0.0 1211 8 0.0 1211 9 0.0 1211 10 0.0 1211 11 0.0 1211 12 0.0 1211 13 0.0 1211 14 0.0 1211 15 0.0 1211 16 0.0 1211 17 0.0 1211 18 0.0 1211 19 0.0 1211 20 0.0 1211 21 0.0 1211 22 0.0 1211 23 0.0 1211 24 0.0 1211 25 0.0 1211 26 0.0 1211 27 0.0 1211 28 0.0 1211 29 0.0 1211 30 0.0 1211 31 0.0 1211 32 0.0 1211 33 0.0 1211 34 0.0 1211 35 0.0 1211 36 0.0 1211 37 0.0 1211 38 0.0 1211 39 0.0 1211 40 0.0 1211 41 0.0 1211 42 0.0 1211 43 0.0 1211 44 0.0 1211 45 0.0 1211 46 0.0 1211 47 0.0 1211 48 0.0 1211 49 0.0 1211 50 0.0 1211 51 0.0 1211 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 1.0 23 4.0 24 3.0 25 3.0 26 12.0 27 14.0 28 18.0 29 37.0 30 49.0 31 62.0 32 88.0 33 97.0 34 139.0 35 201.0 36 300.0 37 390.0 38 703.0 39 1869.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.09229997491848 12.289942312515675 7.298720842738901 44.31903686982694 2 22.575 14.774999999999999 36.225 26.424999999999997 3 21.325 18.825 24.65 35.199999999999996 4 24.325 27.125 21.4 27.150000000000002 5 24.15 31.3 23.375 21.175 6 18.85 32.875 25.2 23.075000000000003 7 14.725 22.775000000000002 41.6 20.9 8 16.225 22.075 31.75 29.95 9 17.2 21.325 34.849999999999994 26.625 10 19.225 36.6 24.275 19.900000000000002 11 23.95 26.625 22.975 26.450000000000003 12 21.675 25.25 27.425 25.650000000000002 13 20.45 27.250000000000004 28.825 23.474999999999998 14 21.075 25.074999999999996 28.7 25.15 15 19.425 25.874999999999996 28.425 26.275 16 20.45 27.3 26.974999999999998 25.275 17 21.175 27.250000000000004 25.825 25.75 18 20.45 25.85 26.974999999999998 26.724999999999998 19 21.224999999999998 27.025 26.974999999999998 24.775 20 21.3 26.424999999999997 26.125 26.150000000000002 21 21.725 25.174999999999997 27.05 26.05 22 20.4 26.525 26.950000000000003 26.125 23 20.4 26.1 28.249999999999996 25.25 24 21.95 23.375 27.35 27.325 25 20.525 26.075 26.900000000000002 26.5 26 20.9 26.224999999999998 27.224999999999998 25.650000000000002 27 20.875 25.624999999999996 27.075 26.424999999999997 28 21.175 27.05 26.900000000000002 24.875 29 20.8 25.75 27.85 25.6 30 20.65 25.3 27.900000000000002 26.150000000000002 31 20.45 27.250000000000004 26.0 26.3 32 20.549999999999997 25.1 27.075 27.275 33 20.674999999999997 25.95 27.700000000000003 25.674999999999997 34 21.075 25.825 25.25 27.85 35 21.925 25.374999999999996 27.400000000000002 25.3 36 20.974999999999998 25.0 27.700000000000003 26.325 37 20.575 26.6 26.525 26.3 38 22.475 26.075 26.700000000000003 24.75 39 21.099999999999998 25.775 26.474999999999998 26.650000000000002 40 20.125 27.075 26.325 26.474999999999998 41 21.625 26.825 26.275 25.275 42 21.525 25.025 25.874999999999996 27.575 43 21.7 25.624999999999996 26.375 26.3 44 21.275 26.450000000000003 26.400000000000002 25.874999999999996 45 22.2 23.7 28.125 25.974999999999998 46 19.725 26.35 26.974999999999998 26.950000000000003 47 22.425 25.05 26.575 25.95 48 21.2 24.775 26.950000000000003 27.075 49 20.175 27.525 27.125 25.174999999999997 50 21.099999999999998 24.625 27.425 26.85 51 21.325 22.900000000000002 27.800000000000004 27.975 52 21.2 24.075 27.400000000000002 27.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 2.5 23 5.0 24 6.5 25 8.0 26 14.0 27 20.0 28 23.5 29 27.0 30 38.5 31 50.0 32 58.0 33 66.0 34 81.5 35 97.0 36 120.5 37 144.0 38 175.0 39 221.5 40 237.0 41 275.0 42 313.0 43 323.5 44 334.0 45 346.5 46 359.0 47 375.5 48 392.0 49 393.0 50 394.0 51 376.0 52 358.0 53 318.0 54 278.0 55 256.0 56 234.0 57 202.5 58 171.0 59 144.0 60 117.0 61 93.0 62 69.0 63 60.5 64 40.5 65 29.0 66 23.0 67 17.0 68 11.5 69 6.0 70 6.5 71 7.0 72 6.0 73 5.0 74 3.5 75 2.0 76 1.0 77 0.0 78 0.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19314170448816 98.35000000000001 2 0.7564296520423601 1.5 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra Read 200000 spots for SRR5423566.sra Written 200000 spots for SRR5423566.sra SRR ids: ['SRR5423566.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gonujsdg SRR5423566.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423566 file size 703998 SRR5423566 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423566 SRR5423566_1.fastq Input file: SRR5423566_1.fastq trimmed: SRR5423566-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:31:31 2025 >> started Thu Feb 13 14:31:33 2025 >> done (1.899s) 4000000 reads processed; of these: 313 ( 0.01%) short reads filtered out after trimming by size control 465 ( 0.01%) empty reads filtered out after trimming by size control 3999222 (99.98%) reads available; of these: 51762 ( 1.29%) trimmed reads available after processing 3947460 (98.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 9 0.00% 21 1 0.00% 22 1 0.00% 23 0 0.00% 24 1 0.00% 25 6 0.00% 26 3 0.00% 27 2 0.00% 28 5 0.00% 29 5 0.00% 30 7 0.00% 31 7 0.00% 32 22 0.00% 33 28 0.00% 34 19 0.00% 35 25 0.00% 36 17 0.00% 37 25 0.00% 38 44 0.00% 39 68 0.00% 40 65 0.00% 41 79 0.00% 42 74 0.00% 43 130 0.00% 44 187 0.00% 45 261 0.01% 46 359 0.01% 47 558 0.01% 48 905 0.02% 49 1819 0.05% 50 5797 0.14% 51 41212 1.03% 52 3947460 98.71% 3999222 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.34 fanout-score-rank=34 prefix-density=0.19 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=206.96 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.0 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:31:46 Started mapping on | Feb 13 14:31:47 Finished on | Feb 13 14:31:51 Mapping speed, Million of reads per hour | 3599.30 Number of input reads | 3999222 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3662798 Uniquely mapped reads % | 91.59% Average mapped length | 51.82 Number of splices: Total | 485879 Number of splices: Annotated (sjdb) | 478083 Number of splices: GT/AG | 479268 Number of splices: GC/AG | 5780 Number of splices: AT/AC | 335 Number of splices: Non-canonical | 496 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264090 % of reads mapped to multiple loci | 6.60% Number of reads mapped to too many loci | 43613 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72334 72334 72334 N_multimapping 264090 264090 264090 N_noFeature 128485 3630515 142856 N_ambiguous 29072 47 11141 UnstrandedReadsAssigned:3505241 PositiveStrandReadsAssigned:32236 NegativeStrandReadsAssigned:3508801 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423566 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423566-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,222 reads, 3,673,801 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR5423566.ke.tsv 34699 SRR5423566.se.tsv 87100 total ==> SRR5423566.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 160.535 26.4967 Potri.005G024800.1.v4.1 1035 936 30.0093 10.1549 Potri.004G059700.1.v4.1 961 862 16 5.87908 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 65.3319 7.27599 Potri.016G087400.1.v4.1 270 171 206 381.564 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 8.38622 1.58674 Potri.012G127500.1.v4.1 977 878 1762 635.635 ==> SRR5423566.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 17 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 99 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 33 SRR5423566 completed mapping pipeline successfully