Starting /dee2/code/volunteer_pipeline.sh SRR5423567 current disk space = 3089575211008 free memory = 1436628628 SRR5423567 SRAfilesize 6039ec2aee5a78a0b196b5c8cb843453 SRR5423567.sra SRR5423567.sra file validated SRR5423567 is single end SRR5423567 is conventional basespace SRR5423567 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423567_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0145 31.0 31.0 34.0 25.0 34.0 2 31.92525 33.0 31.0 34.0 30.0 34.0 3 32.23025 34.0 31.0 34.0 30.0 34.0 4 29.80675 35.0 25.0 37.0 10.0 37.0 5 33.55 35.0 33.0 37.0 28.0 37.0 6 34.95475 35.0 35.0 37.0 32.0 37.0 7 35.4305 37.0 35.0 37.0 33.0 37.0 8 35.74725 37.0 35.0 37.0 35.0 37.0 9 37.6345 39.0 37.0 39.0 35.0 39.0 10 37.60725 39.0 37.0 39.0 35.0 39.0 11 37.417 39.0 37.0 39.0 34.0 39.0 12 37.59975 39.0 37.0 39.0 35.0 39.0 13 37.655 39.0 37.0 39.0 35.0 39.0 14 38.9805 40.0 38.0 41.0 36.0 41.0 15 38.9845 40.0 38.0 41.0 36.0 41.0 16 38.9295 40.0 38.0 41.0 35.0 41.0 17 38.984 40.0 38.0 41.0 36.0 41.0 18 39.0175 40.0 38.0 41.0 36.0 41.0 19 38.882 40.0 38.0 41.0 35.0 41.0 20 38.78375 40.0 38.0 41.0 34.0 41.0 21 38.9125 40.0 38.0 41.0 35.0 41.0 22 38.77825 40.0 38.0 41.0 35.0 41.0 23 38.76475 40.0 38.0 41.0 35.0 41.0 24 38.849 40.0 38.0 41.0 35.0 41.0 25 38.95275 40.0 38.0 41.0 35.0 41.0 26 38.90425 40.0 38.0 41.0 35.0 41.0 27 38.57175 40.0 38.0 41.0 34.0 41.0 28 38.6935 40.0 38.0 41.0 34.0 41.0 29 38.7795 40.0 38.0 41.0 35.0 41.0 30 38.683 40.0 38.0 41.0 35.0 41.0 31 38.8075 40.0 38.0 41.0 35.0 41.0 32 38.63925 40.0 38.0 41.0 34.0 41.0 33 38.801 40.0 38.0 41.0 35.0 41.0 34 38.65875 40.0 38.0 41.0 35.0 41.0 35 38.556 40.0 38.0 41.0 34.0 41.0 36 38.58275 40.0 38.0 41.0 34.0 41.0 37 38.526 40.0 38.0 41.0 34.0 41.0 38 38.52325 40.0 38.0 41.0 34.0 41.0 39 38.37825 40.0 38.0 41.0 34.0 41.0 40 38.22775 40.0 38.0 41.0 33.0 41.0 41 38.2515 40.0 38.0 41.0 33.0 41.0 42 38.21 40.0 38.0 41.0 33.0 41.0 43 38.08375 40.0 38.0 41.0 33.0 41.0 44 38.0245 40.0 38.0 41.0 33.0 41.0 45 37.87525 40.0 37.0 41.0 33.0 41.0 46 37.88475 40.0 37.0 41.0 33.0 41.0 47 37.902 40.0 37.0 41.0 33.0 41.0 48 37.84675 40.0 37.0 41.0 33.0 41.0 49 37.8695 40.0 37.0 41.0 33.0 41.0 50 37.798 40.0 37.0 41.0 33.0 41.0 51 37.7675 40.0 37.0 41.0 32.0 41.0 52 36.8215 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1308 1 0.0 1308 2 0.0 1308 3 0.0 1308 4 0.0 1308 5 0.0 1308 6 0.0 1308 7 0.0 1308 8 0.0 1308 9 0.0 1308 10 0.0 1308 11 0.0 1308 12 0.0 1308 13 0.0 1308 14 0.0 1308 15 0.0 1308 16 0.0 1308 17 0.0 1308 18 0.0 1308 19 0.0 1308 20 0.0 1308 21 0.0 1308 22 0.0 1308 23 0.0 1308 24 0.0 1308 25 0.0 1308 26 0.0 1308 27 0.0 1308 28 0.0 1308 29 0.0 1308 30 0.0 1308 31 0.0 1308 32 0.0 1308 33 0.0 1308 34 0.0 1308 35 0.0 1308 36 0.0 1308 37 0.0 1308 38 0.0 1308 39 0.0 1308 40 0.0 1308 41 0.0 1308 42 0.0 1308 43 0.0 1308 44 0.0 1308 45 0.0 1308 46 0.0 1308 47 0.0 1308 48 0.0 1308 49 0.0 1308 50 0.0 1308 51 0.0 1308 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 2.0 22 1.0 23 3.0 24 3.0 25 5.0 26 10.0 27 23.0 28 33.0 29 41.0 30 44.0 31 67.0 32 84.0 33 112.0 34 140.0 35 210.0 36 280.0 37 448.0 38 882.0 39 1600.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.02777082812109 11.308481361020766 6.429822366775081 45.23392544408306 2 21.85 15.125 37.35 25.674999999999997 3 21.95 18.425 24.725 34.9 4 27.05 24.975 21.6 26.375 5 25.55 31.724999999999998 22.6 20.125 6 19.6 32.525 23.974999999999998 23.9 7 14.799999999999999 23.549999999999997 42.35 19.3 8 17.150000000000002 21.825 33.275 27.750000000000004 9 18.0 19.975 33.875 28.15 10 18.15 36.15 25.374999999999996 20.325 11 23.25 27.975 22.3 26.474999999999998 12 22.125 23.35 26.974999999999998 27.55 13 20.375 25.924999999999997 29.075 24.625 14 19.475 26.174999999999997 29.15 25.2 15 21.15 25.35 27.175 26.325 16 20.65 27.025 26.75 25.575 17 19.875 26.724999999999998 27.35 26.05 18 19.525000000000002 26.200000000000003 27.275 27.0 19 21.25 25.650000000000002 26.6 26.5 20 22.425 25.474999999999998 27.125 24.975 21 20.775 26.25 28.375 24.6 22 22.025 25.35 27.150000000000002 25.474999999999998 23 20.674999999999997 26.650000000000002 27.625 25.05 24 20.9 25.074999999999996 27.625 26.400000000000002 25 22.225 26.224999999999998 25.775 25.775 26 20.8 26.724999999999998 27.525 24.95 27 21.075 26.525 26.674999999999997 25.724999999999998 28 20.724999999999998 26.3 26.275 26.700000000000003 29 20.525 26.1 27.55 25.825 30 20.95 25.95 27.325 25.775 31 20.925 27.125 25.75 26.200000000000003 32 20.925 27.35 27.35 24.375 33 22.2 25.124999999999996 28.125 24.55 34 20.474999999999998 26.3 26.85 26.375 35 22.125 25.55 27.0 25.324999999999996 36 21.65 24.375 27.125 26.85 37 21.575 25.900000000000002 26.325 26.200000000000003 38 22.275 26.200000000000003 27.125 24.4 39 21.275 26.325 26.775 25.624999999999996 40 22.225 26.650000000000002 25.25 25.874999999999996 41 21.2 25.900000000000002 27.575 25.324999999999996 42 21.175 25.55 26.974999999999998 26.3 43 21.80545136284071 26.281570392598148 25.30632658164541 26.60665166291573 44 21.5 24.975 27.875 25.650000000000002 45 20.150000000000002 24.125 28.449999999999996 27.275 46 21.380345086271568 26.056514128532132 26.18154538634659 26.38159539884971 47 20.530132533133283 26.03150787696924 27.33183295823956 26.106526631657918 48 20.97622027534418 25.60700876095119 27.133917396745932 26.282853566958696 49 21.475 25.275 27.0 26.25 50 21.290968226169625 25.74430823117338 27.24543407555667 25.719289467100324 51 21.85 24.175 27.500000000000004 26.474999999999998 52 22.15 25.6 26.1 26.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 3.5 23 4.0 24 8.5 25 13.0 26 15.0 27 17.0 28 18.5 29 20.0 30 34.5 31 49.0 32 55.5 33 62.0 34 90.0 35 118.0 36 134.5 37 151.0 38 159.0 39 218.0 40 269.0 41 276.0 42 283.0 43 320.5 44 358.0 45 358.0 46 358.0 47 375.5 48 393.0 49 383.0 50 373.0 51 371.5 52 370.0 53 333.0 54 296.0 55 264.0 56 232.0 57 200.5 58 169.0 59 138.0 60 107.0 61 88.5 62 70.0 63 55.0 64 36.0 65 32.0 66 25.0 67 18.0 68 15.0 69 12.0 70 10.5 71 9.0 72 6.0 73 3.0 74 2.5 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.025 44 0.0 45 0.0 46 0.025 47 0.025 48 0.125 49 0.0 50 0.075 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57243460764587 98.97500000000001 2 0.30181086519114686 0.6 3 0.07545271629778671 0.22499999999999998 4 0.05030181086519115 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra Read 200000 spots for SRR5423567.sra Written 200000 spots for SRR5423567.sra SRR ids: ['SRR5423567.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_95obprsg SRR5423567.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423567 file size 703961 SRR5423567 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423567 SRR5423567_1.fastq Input file: SRR5423567_1.fastq trimmed: SRR5423567-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:33:57 2025 >> started Thu Feb 13 14:33:59 2025 >> done (1.848s) 4000000 reads processed; of these: 289 ( 0.01%) short reads filtered out after trimming by size control 393 ( 0.01%) empty reads filtered out after trimming by size control 3999318 (99.98%) reads available; of these: 53689 ( 1.34%) trimmed reads available after processing 3945629 (98.66%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 9 0.00% 20 7 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 3 0.00% 27 1 0.00% 28 2 0.00% 29 3 0.00% 30 11 0.00% 31 13 0.00% 32 19 0.00% 33 21 0.00% 34 19 0.00% 35 16 0.00% 36 34 0.00% 37 29 0.00% 38 30 0.00% 39 57 0.00% 40 60 0.00% 41 80 0.00% 42 97 0.00% 43 139 0.00% 44 166 0.00% 45 253 0.01% 46 328 0.01% 47 490 0.01% 48 882 0.02% 49 1901 0.05% 50 5756 0.14% 51 43248 1.08% 52 3945629 98.66% 3999318 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=32 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=11 fanout-score=163.47 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=21.4 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:34:12 Started mapping on | Feb 13 14:34:12 Finished on | Feb 13 14:34:16 Mapping speed, Million of reads per hour | 3599.39 Number of input reads | 3999318 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3661969 Uniquely mapped reads % | 91.56% Average mapped length | 51.82 Number of splices: Total | 484938 Number of splices: Annotated (sjdb) | 477149 Number of splices: GT/AG | 478324 Number of splices: GC/AG | 5729 Number of splices: AT/AC | 360 Number of splices: Non-canonical | 525 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 264579 % of reads mapped to multiple loci | 6.62% Number of reads mapped to too many loci | 43896 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72770 72770 72770 N_multimapping 264579 264579 264579 N_noFeature 129308 3629699 143529 N_ambiguous 29222 64 11145 UnstrandedReadsAssigned:3503439 PositiveStrandReadsAssigned:32206 NegativeStrandReadsAssigned:3507295 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423567 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423567-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,318 reads, 3,669,857 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,186 rounds 52401 SRR5423567.ke.tsv 34699 SRR5423567.se.tsv 87100 total ==> SRR5423567.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 187 30.9056 Potri.005G024800.1.v4.1 1035 936 21.0133 7.12015 Potri.004G059700.1.v4.1 961 862 14 5.151 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 69.9816 7.80414 Potri.016G087400.1.v4.1 270 171 166 307.881 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 20.7781 3.9366 Potri.012G127500.1.v4.1 977 878 1834 662.485 ==> SRR5423567.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 11 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 100 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 39 SRR5423567 completed mapping pipeline successfully