Starting /dee2/code/volunteer_pipeline.sh SRR5423568 current disk space = 3089112571904 free memory = 1582441872 SRR5423568 SRAfilesize e652c36963575161e0d09e6b915de42b SRR5423568.sra SRR5423568.sra file validated SRR5423568 is single end SRR5423568 is conventional basespace SRR5423568 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423568_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66675 34.0 31.0 34.0 31.0 34.0 2 32.75875 34.0 31.0 34.0 31.0 34.0 3 32.811 34.0 31.0 34.0 31.0 34.0 4 36.177 37.0 37.0 37.0 35.0 37.0 5 36.179 37.0 37.0 37.0 35.0 37.0 6 36.121 37.0 37.0 37.0 35.0 37.0 7 36.126 37.0 36.0 37.0 35.0 37.0 8 36.19075 37.0 36.0 37.0 35.0 37.0 9 37.8935 39.0 38.0 39.0 35.0 39.0 10 37.83825 39.0 38.0 39.0 35.0 39.0 11 37.83775 39.0 38.0 39.0 35.0 39.0 12 37.86675 39.0 38.0 39.0 35.0 39.0 13 37.86225 39.0 38.0 39.0 35.0 39.0 14 39.3465 41.0 39.0 41.0 36.0 41.0 15 39.363 41.0 39.0 41.0 36.0 41.0 16 39.30625 41.0 39.0 41.0 36.0 41.0 17 39.29925 41.0 39.0 41.0 36.0 41.0 18 39.356 41.0 39.0 41.0 36.0 41.0 19 39.39 41.0 39.0 41.0 36.0 41.0 20 39.275 41.0 39.0 41.0 36.0 41.0 21 39.254 41.0 39.0 41.0 36.0 41.0 22 39.28325 40.0 39.0 41.0 36.0 41.0 23 39.2185 40.0 39.0 41.0 36.0 41.0 24 39.24175 41.0 39.0 41.0 36.0 41.0 25 39.34725 41.0 39.0 41.0 36.0 41.0 26 39.26425 41.0 39.0 41.0 36.0 41.0 27 39.1395 40.0 39.0 41.0 36.0 41.0 28 39.00875 40.0 39.0 41.0 35.0 41.0 29 39.0955 40.0 39.0 41.0 36.0 41.0 30 39.12275 40.0 39.0 41.0 36.0 41.0 31 39.0625 40.0 39.0 41.0 35.0 41.0 32 38.9705 40.0 38.0 41.0 35.0 41.0 33 38.8595 40.0 38.0 41.0 35.0 41.0 34 38.9555 40.0 38.0 41.0 35.0 41.0 35 38.71625 40.0 38.0 41.0 35.0 41.0 36 38.6615 40.0 38.0 41.0 35.0 41.0 37 38.589 40.0 38.0 41.0 34.0 41.0 38 38.7755 40.0 38.0 41.0 35.0 41.0 39 38.7815 40.0 38.0 41.0 35.0 41.0 40 38.5115 40.0 38.0 41.0 34.0 41.0 41 38.5395 40.0 38.0 41.0 34.0 41.0 42 38.6025 40.0 38.0 41.0 34.0 41.0 43 38.5285 40.0 38.0 41.0 34.0 41.0 44 38.40125 40.0 38.0 41.0 34.0 41.0 45 38.33375 40.0 38.0 41.0 34.0 41.0 46 38.35275 40.0 38.0 41.0 34.0 41.0 47 38.36125 40.0 38.0 41.0 34.0 41.0 48 38.08575 40.0 37.0 41.0 33.0 41.0 49 38.1115 40.0 38.0 41.0 33.0 41.0 50 38.202 40.0 37.0 41.0 33.0 41.0 51 37.91025 40.0 37.0 41.0 33.0 41.0 52 36.74375 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2105 1 0.0 2105 2 0.0 2105 3 0.0 2105 4 0.0 2105 5 0.0 2105 6 0.0 2105 7 0.0 2105 8 0.0 2105 9 0.0 2105 10 0.0 2105 11 0.0 2105 12 0.0 2105 13 0.0 2105 14 0.0 2105 15 0.0 2105 16 0.0 2105 17 0.0 2105 18 0.0 2105 19 0.0 2105 20 0.0 2105 21 0.0 2105 22 0.0 2105 23 0.0 2105 24 0.0 2105 25 0.0 2105 26 0.0 2105 27 0.0 2105 28 0.0 2105 29 0.0 2105 30 0.0 2105 31 0.0 2105 32 0.0 2105 33 0.0 2105 34 0.0 2105 35 0.0 2105 36 0.0 2105 37 0.0 2105 38 0.0 2105 39 0.0 2105 40 0.0 2105 41 0.0 2105 42 0.0 2105 43 0.0 2105 44 0.0 2105 45 0.0 2105 46 0.0 2105 47 0.0 2105 48 0.0 2105 49 0.0 2105 50 0.0 2105 51 0.0 2105 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 8.0 25 6.0 26 7.0 27 9.0 28 18.0 29 20.0 30 29.0 31 59.0 32 67.0 33 84.0 34 111.0 35 143.0 36 226.0 37 377.0 38 669.0 39 2155.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.66591535186576 11.219634360130227 6.912096168294515 44.20235411970949 2 22.8 14.274999999999999 35.825 27.1 3 22.0 18.675 25.025 34.300000000000004 4 24.75 25.624999999999996 22.5 27.125 5 24.0 31.075000000000003 24.025 20.9 6 18.675 31.35 25.45 24.525 7 13.875000000000002 22.900000000000002 42.55 20.674999999999997 8 17.849999999999998 21.8 31.775 28.575 9 18.125 21.65 34.35 25.874999999999996 10 18.4 36.6 24.775 20.225 11 22.8 26.8 21.65 28.749999999999996 12 20.925 23.75 27.875 27.450000000000003 13 19.900000000000002 25.724999999999998 28.525 25.85 14 19.625 25.45 28.999999999999996 25.924999999999997 15 19.85 25.45 27.275 27.425 16 21.825 25.874999999999996 27.625 24.675 17 21.625 25.35 27.025 26.0 18 20.424999999999997 26.150000000000002 26.200000000000003 27.224999999999998 19 20.1 26.625 27.500000000000004 25.775 20 21.525 25.424999999999997 27.275 25.775 21 19.975 25.650000000000002 28.025 26.35 22 20.575 26.325 28.225 24.875 23 20.925 25.974999999999998 27.325 25.775 24 21.275 26.200000000000003 26.85 25.674999999999997 25 21.65 26.174999999999997 26.525 25.650000000000002 26 21.275 24.65 27.775 26.3 27 21.15 25.4 26.924999999999997 26.525 28 21.15 26.775 27.750000000000004 24.325 29 20.075000000000003 24.75 28.375 26.8 30 20.5 25.0 27.925 26.575 31 20.9 26.8 28.125 24.175 32 21.55 26.650000000000002 26.775 25.025 33 20.349999999999998 25.525 26.85 27.275 34 21.349999999999998 26.25 26.025 26.375 35 20.825 25.074999999999996 27.175 26.924999999999997 36 21.675 24.325 26.224999999999998 27.775 37 21.125 25.25 26.5 27.125 38 20.474999999999998 24.875 27.175 27.474999999999998 39 20.95 24.15 27.425 27.474999999999998 40 20.674999999999997 26.674999999999997 26.724999999999998 25.924999999999997 41 21.45 25.525 26.775 26.25 42 20.75 24.975 26.75 27.525 43 20.65 26.974999999999998 26.575 25.8 44 21.4 25.424999999999997 26.025 27.150000000000002 45 21.330332583145786 25.78144536134033 27.056764191047762 25.831457864466117 46 22.155538884721178 24.781195298824706 25.35633908477119 27.70692673168292 47 21.371371371371374 24.124124124124123 26.651651651651655 27.852852852852855 48 21.946946946946948 24.14914914914915 26.276276276276278 27.627627627627625 49 21.10527631907977 25.906476619154787 26.806701675418854 26.18154538634659 50 21.605401350337583 24.85621405351338 28.207051762940733 25.331332833208304 51 21.405351337834457 23.905976494123532 27.481870467616904 27.206801700425103 52 21.375 25.775 26.474999999999998 26.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.0 16 1.0 17 2.0 18 3.0 19 4.0 20 5.5 21 7.0 22 6.0 23 5.0 24 7.5 25 10.0 26 13.0 27 16.0 28 21.5 29 27.0 30 34.0 31 41.0 32 49.0 33 57.0 34 73.5 35 90.0 36 112.5 37 135.0 38 161.5 39 204.5 40 221.0 41 276.5 42 332.0 43 327.0 44 322.0 45 358.0 46 394.0 47 386.0 48 378.0 49 385.5 50 393.0 51 370.0 52 347.0 53 327.5 54 308.0 55 264.0 56 220.0 57 187.5 58 155.0 59 134.0 60 113.0 61 98.5 62 84.0 63 68.0 64 41.5 65 31.0 66 30.0 67 29.0 68 21.0 69 13.0 70 12.0 71 11.0 72 7.5 73 4.0 74 3.0 75 2.0 76 3.5 77 5.0 78 3.0 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.025 46 0.025 47 0.1 48 0.1 49 0.025 50 0.025 51 0.025 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5541561712846348 1.0999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra Read 200000 spots for SRR5423568.sra Written 200000 spots for SRR5423568.sra SRR ids: ['SRR5423568.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cpvp8jq3 SRR5423568.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423568 file size 703987 SRR5423568 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423568 SRR5423568_1.fastq Input file: SRR5423568_1.fastq trimmed: SRR5423568-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:06:26 2025 >> started Thu Feb 13 15:06:28 2025 >> done (2.023s) 4000000 reads processed; of these: 285 ( 0.01%) short reads filtered out after trimming by size control 402 ( 0.01%) empty reads filtered out after trimming by size control 3999313 (99.98%) reads available; of these: 50301 ( 1.26%) trimmed reads available after processing 3949012 (98.74%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 12 0.00% 20 8 0.00% 21 1 0.00% 22 5 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 3 0.00% 27 9 0.00% 28 3 0.00% 29 5 0.00% 30 3 0.00% 31 6 0.00% 32 20 0.00% 33 32 0.00% 34 20 0.00% 35 21 0.00% 36 20 0.00% 37 29 0.00% 38 33 0.00% 39 49 0.00% 40 86 0.00% 41 78 0.00% 42 94 0.00% 43 150 0.00% 44 200 0.01% 45 240 0.01% 46 375 0.01% 47 552 0.01% 48 949 0.02% 49 1857 0.05% 50 5682 0.14% 51 39734 0.99% 52 3949012 98.74% 3999313 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=33 prefix-density=0.11 prefix-fanout=2.0 sequence=TGCACCGGTGGTATCTT criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=180.64 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.7 sequence=CTTCTTCTTCTT Started job on | Feb 13 15:06:41 Started mapping on | Feb 13 15:06:41 Finished on | Feb 13 15:06:46 Mapping speed, Million of reads per hour | 2879.51 Number of input reads | 3999313 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3661945 Uniquely mapped reads % | 91.56% Average mapped length | 51.82 Number of splices: Total | 484909 Number of splices: Annotated (sjdb) | 477205 Number of splices: GT/AG | 478279 Number of splices: GC/AG | 5855 Number of splices: AT/AC | 292 Number of splices: Non-canonical | 483 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265249 % of reads mapped to multiple loci | 6.63% Number of reads mapped to too many loci | 43533 % of reads mapped to too many loci | 1.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.71% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72119 72119 72119 N_multimapping 265249 265249 265249 N_noFeature 129387 3629893 143637 N_ambiguous 28875 56 11055 UnstrandedReadsAssigned:3503683 PositiveStrandReadsAssigned:31996 NegativeStrandReadsAssigned:3507253 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423568 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423568-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,313 reads, 3,658,246 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,124 rounds 52401 SRR5423568.ke.tsv 34699 SRR5423568.se.tsv 87100 total ==> SRR5423568.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 188 31.1573 Potri.005G024800.1.v4.1 1035 936 23 7.81499 Potri.004G059700.1.v4.1 961 862 8 2.95161 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.857 6.80546 Potri.016G087400.1.v4.1 270 171 199 370.112 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 14.5354 2.76152 Potri.012G127500.1.v4.1 977 878 1939 702.36 ==> SRR5423568.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 19 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 99 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 30 SRR5423568 completed mapping pipeline successfully