Starting /dee2/code/volunteer_pipeline.sh SRR5423569 current disk space = 3089478172672 free memory = 1452853400 SRR5423569 SRAfilesize d2ce61cf3bc5a4ddae0aa819f6644f16 SRR5423569.sra SRR5423569.sra file validated SRR5423569 is single end SRR5423569 is conventional basespace SRR5423569 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423569_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8565 34.0 31.0 34.0 31.0 34.0 2 32.98075 34.0 33.0 34.0 31.0 34.0 3 33.067 34.0 33.0 34.0 31.0 34.0 4 36.37725 37.0 37.0 37.0 35.0 37.0 5 36.36 37.0 37.0 37.0 35.0 37.0 6 36.33575 37.0 37.0 37.0 35.0 37.0 7 36.3995 37.0 37.0 37.0 35.0 37.0 8 36.338 37.0 37.0 37.0 35.0 37.0 9 38.1035 39.0 39.0 39.0 37.0 39.0 10 38.06625 39.0 39.0 39.0 37.0 39.0 11 38.1395 39.0 39.0 39.0 37.0 39.0 12 38.0865 39.0 38.0 39.0 37.0 39.0 13 38.08275 39.0 38.0 39.0 37.0 39.0 14 39.618 41.0 40.0 41.0 37.0 41.0 15 39.662 41.0 40.0 41.0 37.0 41.0 16 39.62625 41.0 40.0 41.0 37.0 41.0 17 39.555 41.0 39.0 41.0 37.0 41.0 18 39.5365 41.0 40.0 41.0 37.0 41.0 19 39.5425 41.0 40.0 41.0 37.0 41.0 20 39.52675 41.0 40.0 41.0 37.0 41.0 21 39.5265 41.0 40.0 41.0 37.0 41.0 22 39.4345 41.0 39.0 41.0 37.0 41.0 23 39.39125 41.0 39.0 41.0 37.0 41.0 24 39.45875 41.0 39.0 41.0 37.0 41.0 25 39.459 41.0 39.0 41.0 37.0 41.0 26 39.31975 41.0 39.0 41.0 36.0 41.0 27 39.21225 41.0 39.0 41.0 36.0 41.0 28 39.29675 41.0 39.0 41.0 36.0 41.0 29 39.1975 41.0 39.0 41.0 36.0 41.0 30 39.2065 41.0 39.0 41.0 36.0 41.0 31 39.04675 41.0 39.0 41.0 36.0 41.0 32 39.06675 41.0 39.0 41.0 36.0 41.0 33 39.08125 41.0 39.0 41.0 36.0 41.0 34 39.055 40.0 39.0 41.0 36.0 41.0 35 39.01825 40.0 39.0 41.0 36.0 41.0 36 38.8415 40.0 39.0 41.0 35.0 41.0 37 38.8385 40.0 39.0 41.0 35.0 41.0 38 38.7845 40.0 38.0 41.0 35.0 41.0 39 38.78275 40.0 39.0 41.0 35.0 41.0 40 38.575 40.0 38.0 41.0 34.0 41.0 41 38.5295 40.0 38.0 41.0 34.0 41.0 42 38.52075 40.0 38.0 41.0 35.0 41.0 43 38.48975 40.0 38.0 41.0 34.0 41.0 44 38.4125 40.0 38.0 41.0 34.0 41.0 45 38.389 40.0 38.0 41.0 34.0 41.0 46 38.2605 40.0 38.0 41.0 34.0 41.0 47 38.2165 40.0 38.0 41.0 34.0 41.0 48 38.1445 40.0 38.0 41.0 33.0 41.0 49 38.185 40.0 38.0 41.0 33.0 41.0 50 38.124 40.0 38.0 41.0 33.0 41.0 51 38.0805 40.0 38.0 41.0 33.0 41.0 52 36.574 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2202 1 0.0 2202 2 0.0 2202 3 0.0 2202 4 0.0 2202 5 0.0 2202 6 0.0 2202 7 0.0 2202 8 0.0 2202 9 0.0 2202 10 0.0 2202 11 0.0 2202 12 0.0 2202 13 0.0 2202 14 0.0 2202 15 0.0 2202 16 0.0 2202 17 0.0 2202 18 0.0 2202 19 0.0 2202 20 0.0 2202 21 0.0 2202 22 0.0 2202 23 0.0 2202 24 0.0 2202 25 0.0 2202 26 0.0 2202 27 0.0 2202 28 0.0 2202 29 0.0 2202 30 0.0 2202 31 0.0 2202 32 0.0 2202 33 0.0 2202 34 0.0 2202 35 0.0 2202 36 0.0 2202 37 0.0 2202 38 0.0 2202 39 0.0 2202 40 0.0 2202 41 0.0 2202 42 0.0 2202 43 0.0 2202 44 0.0 2202 45 0.0 2202 46 0.0 2202 47 0.0 2202 48 0.0 2202 49 0.0 2202 50 0.0 2202 51 0.0 2202 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 3.0 21 3.0 22 4.0 23 3.0 24 5.0 25 4.0 26 7.0 27 10.0 28 22.0 29 31.0 30 33.0 31 41.0 32 47.0 33 80.0 34 79.0 35 131.0 36 181.0 37 291.0 38 630.0 39 2375.0 40 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.35170340681363 11.24749498997996 6.838677354709419 43.56212424849699 2 22.475 13.3 37.85 26.375 3 21.45 18.224999999999998 24.55 35.775 4 25.275 25.974999999999998 22.400000000000002 26.35 5 24.7 29.7 23.799999999999997 21.8 6 18.725 32.225 23.225 25.825 7 14.249999999999998 23.3 41.975 20.474999999999998 8 17.5 22.75 32.65 27.1 9 17.549999999999997 21.349999999999998 33.45 27.650000000000002 10 18.25 36.075 25.775 19.900000000000002 11 23.05 26.700000000000003 22.15 28.1 12 21.125 24.525 27.125 27.224999999999998 13 19.400000000000002 27.375 27.474999999999998 25.75 14 20.05 26.474999999999998 27.474999999999998 26.0 15 20.05 25.15 28.050000000000004 26.75 16 21.925 26.325 25.575 26.174999999999997 17 21.45 26.650000000000002 27.125 24.775 18 20.325 25.85 27.0 26.825 19 21.575 25.624999999999996 27.400000000000002 25.4 20 20.474999999999998 25.924999999999997 26.950000000000003 26.650000000000002 21 21.775 25.35 26.325 26.55 22 20.575 26.025 27.3 26.1 23 20.925 25.575 28.725 24.775 24 20.3 26.700000000000003 26.0 27.0 25 20.8 26.325 26.224999999999998 26.650000000000002 26 20.724999999999998 25.55 26.625 27.1 27 20.9 25.85 26.650000000000002 26.6 28 21.075 26.05 27.075 25.8 29 21.95 25.05 27.650000000000002 25.35 30 21.95 25.825 25.75 26.474999999999998 31 20.525 26.174999999999997 26.75 26.55 32 21.65 25.275 27.450000000000003 25.624999999999996 33 20.875 25.3 26.625 27.200000000000003 34 21.9 25.8 26.224999999999998 26.075 35 21.2 26.0 27.625 25.174999999999997 36 21.099999999999998 25.95 25.25 27.700000000000003 37 20.549999999999997 26.5 26.450000000000003 26.5 38 21.55 25.15 27.200000000000003 26.1 39 22.05 24.925 26.275 26.75 40 21.75 25.05 25.974999999999998 27.224999999999998 41 22.2 25.825 26.075 25.900000000000002 42 21.825 24.275 27.175 26.724999999999998 43 23.075000000000003 24.775 26.650000000000002 25.5 44 21.925 25.025 27.1 25.95 45 20.525 26.0 26.325 27.150000000000002 46 21.6 26.150000000000002 26.400000000000002 25.85 47 21.075 26.3 27.150000000000002 25.474999999999998 48 22.005501375343837 24.456114028507127 26.25656414103526 27.28182045511378 49 21.10527631907977 25.881470367591895 27.231807951987996 25.78144536134033 50 21.605401350337583 25.98149537384346 26.85671417854464 25.55638909727432 51 21.3 23.5 27.150000000000002 28.050000000000004 52 21.875 25.424999999999997 26.525 26.174999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.5 21 6.0 22 7.0 23 8.0 24 7.0 25 6.0 26 14.0 27 22.0 28 23.0 29 24.0 30 29.5 31 35.0 32 46.5 33 58.0 34 84.0 35 110.0 36 118.5 37 127.0 38 157.5 39 208.5 40 229.0 41 260.5 42 292.0 43 298.5 44 305.0 45 334.0 46 363.0 47 388.5 48 414.0 49 393.0 50 372.0 51 365.5 52 359.0 53 342.0 54 325.0 55 290.0 56 255.0 57 216.5 58 178.0 59 139.0 60 100.0 61 87.5 62 75.0 63 65.5 64 42.0 65 28.0 66 25.0 67 22.0 68 18.5 69 15.0 70 10.0 71 5.0 72 6.5 73 8.0 74 6.5 75 5.0 76 4.5 77 4.0 78 2.5 79 1.0 80 0.5 81 0.0 82 0.5 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2687846696924 98.425 2 0.6555723651033787 1.3 3 0.05042864346949068 0.15 4 0.0 0.0 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCCTCTTTAAAGACCCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra Read 200000 spots for SRR5423569.sra Written 200000 spots for SRR5423569.sra SRR ids: ['SRR5423569.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ak1pu9t0 SRR5423569.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423569 file size 703944 SRR5423569 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423569 SRR5423569_1.fastq Input file: SRR5423569_1.fastq trimmed: SRR5423569-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:39:40 2025 >> started Thu Feb 13 14:39:42 2025 >> done (2.260s) 4000000 reads processed; of these: 278 ( 0.01%) short reads filtered out after trimming by size control 447 ( 0.01%) empty reads filtered out after trimming by size control 3999275 (99.98%) reads available; of these: 52466 ( 1.31%) trimmed reads available after processing 3946809 (98.69%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 12 0.00% 20 12 0.00% 21 0 0.00% 22 1 0.00% 23 2 0.00% 24 6 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 6 0.00% 29 13 0.00% 30 14 0.00% 31 15 0.00% 32 15 0.00% 33 23 0.00% 34 29 0.00% 35 24 0.00% 36 46 0.00% 37 50 0.00% 38 58 0.00% 39 46 0.00% 40 79 0.00% 41 112 0.00% 42 134 0.00% 43 164 0.00% 44 201 0.01% 45 294 0.01% 46 481 0.01% 47 667 0.02% 48 1087 0.03% 49 2195 0.05% 50 5886 0.15% 51 40771 1.02% 52 3946809 98.69% 3999275 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=10 fanout-score=166.09 fanout-score-rank=1 prefix-density=0.50 prefix-fanout=22.1 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:39:56 Started mapping on | Feb 13 14:39:56 Finished on | Feb 13 14:40:06 Mapping speed, Million of reads per hour | 1439.74 Number of input reads | 3999275 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3661005 Uniquely mapped reads % | 91.54% Average mapped length | 51.82 Number of splices: Total | 485385 Number of splices: Annotated (sjdb) | 477406 Number of splices: GT/AG | 478745 Number of splices: GC/AG | 5772 Number of splices: AT/AC | 346 Number of splices: Non-canonical | 522 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.65 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265086 % of reads mapped to multiple loci | 6.63% Number of reads mapped to too many loci | 43878 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.73% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 73184 73184 73184 N_multimapping 265086 265086 265086 N_noFeature 128216 3628836 142548 N_ambiguous 28959 61 11099 UnstrandedReadsAssigned:3503830 PositiveStrandReadsAssigned:32108 NegativeStrandReadsAssigned:3507358 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423569 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423569-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,275 reads, 3,671,635 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR5423569.ke.tsv 34699 SRR5423569.se.tsv 87100 total ==> SRR5423569.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 180 29.742 Potri.005G024800.1.v4.1 1035 936 30.0095 10.1661 Potri.004G059700.1.v4.1 961 862 15 5.51769 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 71.6746 7.99114 Potri.016G087400.1.v4.1 270 171 189 350.46 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.3591 2.90927 Potri.012G127500.1.v4.1 977 878 1866 673.892 ==> SRR5423569.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 15 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 93 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR5423569 completed mapping pipeline successfully