Starting /dee2/code/volunteer_pipeline.sh SRR5423570 current disk space = 3089543176192 free memory = 1401558588 SRR5423570 SRAfilesize 628615ef9f582f57a88cf681e983ae5b SRR5423570.sra SRR5423570.sra file validated SRR5423570 is single end SRR5423570 is conventional basespace SRR5423570 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423570_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.36375 31.0 31.0 34.0 28.0 34.0 2 31.78275 33.0 31.0 34.0 30.0 34.0 3 31.9245 33.0 31.0 34.0 30.0 34.0 4 32.10175 35.0 32.0 37.0 19.0 37.0 5 34.45175 35.0 35.0 37.0 30.0 37.0 6 35.08525 37.0 35.0 37.0 32.0 37.0 7 35.49225 37.0 35.0 37.0 33.0 37.0 8 35.67475 37.0 35.0 37.0 33.0 37.0 9 37.436 39.0 37.0 39.0 35.0 39.0 10 37.2835 39.0 37.0 39.0 34.0 39.0 11 37.20025 39.0 37.0 39.0 33.0 39.0 12 37.297 39.0 37.0 39.0 34.0 39.0 13 37.349 39.0 37.0 39.0 34.0 39.0 14 38.8065 40.0 38.0 41.0 35.0 41.0 15 38.7325 40.0 38.0 41.0 34.0 41.0 16 38.5455 40.0 38.0 41.0 34.0 41.0 17 38.61425 40.0 38.0 41.0 34.0 41.0 18 38.436 40.0 38.0 41.0 33.0 41.0 19 38.53775 40.0 38.0 41.0 34.0 41.0 20 38.306 40.0 38.0 41.0 33.0 41.0 21 38.4725 40.0 38.0 41.0 34.0 41.0 22 38.6015 40.0 38.0 41.0 34.0 41.0 23 38.48975 40.0 38.0 41.0 34.0 41.0 24 38.41825 40.0 38.0 41.0 34.0 41.0 25 38.46925 40.0 38.0 41.0 34.0 41.0 26 38.6235 40.0 38.0 41.0 34.0 41.0 27 38.537 40.0 38.0 41.0 34.0 41.0 28 38.5 40.0 38.0 41.0 34.0 41.0 29 38.3495 40.0 38.0 41.0 34.0 41.0 30 38.48 40.0 38.0 41.0 34.0 41.0 31 38.567 40.0 38.0 41.0 34.0 41.0 32 38.4895 40.0 38.0 41.0 34.0 41.0 33 38.4525 40.0 38.0 41.0 34.0 41.0 34 38.31275 40.0 38.0 41.0 34.0 41.0 35 38.03 40.0 38.0 41.0 33.0 41.0 36 38.142 40.0 38.0 41.0 33.0 41.0 37 38.175 40.0 38.0 41.0 33.0 41.0 38 38.102 40.0 38.0 41.0 33.0 41.0 39 37.991 40.0 38.0 41.0 33.0 41.0 40 37.8795 40.0 37.0 41.0 33.0 41.0 41 37.9105 40.0 37.0 41.0 33.0 41.0 42 37.89175 40.0 37.0 41.0 33.0 41.0 43 37.967 40.0 37.0 41.0 33.0 41.0 44 37.693 40.0 37.0 41.0 33.0 41.0 45 37.877 40.0 37.0 41.0 33.0 41.0 46 37.66125 40.0 37.0 41.0 32.0 41.0 47 37.736 40.0 37.0 41.0 33.0 41.0 48 37.6615 40.0 37.0 41.0 32.0 41.0 49 37.647 40.0 37.0 41.0 32.0 41.0 50 37.44225 40.0 37.0 41.0 31.0 41.0 51 37.32375 40.0 36.0 41.0 31.0 41.0 52 36.86 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2215 1 0.0 2215 2 0.0 2215 3 0.0 2215 4 0.0 2215 5 0.0 2215 6 0.0 2215 7 0.0 2215 8 0.0 2215 9 0.0 2215 10 0.0 2215 11 0.0 2215 12 0.0 2215 13 0.0 2215 14 0.0 2215 15 0.0 2215 16 0.0 2215 17 0.0 2215 18 0.0 2215 19 0.0 2215 20 0.0 2215 21 0.0 2215 22 0.0 2215 23 0.0 2215 24 0.0 2215 25 0.0 2215 26 0.0 2215 27 0.0 2215 28 0.0 2215 29 0.0 2215 30 0.0 2215 31 0.0 2215 32 0.0 2215 33 0.0 2215 34 0.0 2215 35 0.0 2215 36 0.0 2215 37 0.0 2215 38 0.0 2215 39 0.0 2215 40 0.0 2215 41 0.0 2215 42 0.0 2215 43 0.0 2215 44 0.0 2215 45 0.0 2215 46 0.0 2215 47 0.0 2215 48 0.0 2215 49 0.0 2215 50 0.0 2215 51 0.0 2215 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 3.0 24 6.0 25 8.0 26 10.0 27 23.0 28 29.0 29 32.0 30 69.0 31 71.0 32 106.0 33 139.0 34 176.0 35 221.0 36 320.0 37 471.0 38 799.0 39 1505.0 40 8.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.16679188580015 11.870773854244929 6.912096168294515 43.05033809166041 2 21.75 15.525 35.4 27.325 3 22.3 18.625 23.425 35.65 4 25.174999999999997 24.8 23.599999999999998 26.424999999999997 5 23.775 30.15 23.799999999999997 22.275 6 18.099999999999998 31.75 26.275 23.875 7 14.825 22.35 43.65 19.175 8 17.275 21.925 32.45 28.349999999999998 9 17.8 21.3 34.599999999999994 26.3 10 19.05 37.1 25.35 18.5 11 24.025 26.775 22.125 27.075 12 21.825 23.150000000000002 27.3 27.725 13 20.575 25.224999999999998 28.325 25.874999999999996 14 19.375 28.125 27.650000000000002 24.85 15 20.549999999999997 25.0 28.15 26.3 16 21.7 25.825 26.8 25.674999999999997 17 21.175 25.575 26.6 26.650000000000002 18 21.349999999999998 25.2 27.250000000000004 26.200000000000003 19 20.65 26.875 27.3 25.174999999999997 20 20.375 25.650000000000002 28.875 25.1 21 21.680420105026258 25.28132033008252 25.806451612903224 27.231807951987996 22 22.175 25.775 26.05 26.0 23 21.775 25.275 27.125 25.825 24 21.15 25.775 27.650000000000002 25.424999999999997 25 21.224999999999998 24.275 27.275 27.224999999999998 26 20.95 26.3 26.724999999999998 26.025 27 20.375 25.35 27.075 27.200000000000003 28 19.975 26.724999999999998 26.575 26.724999999999998 29 20.1 26.275 28.499999999999996 25.124999999999996 30 21.099999999999998 26.474999999999998 26.875 25.55 31 22.125 25.0 26.1 26.775 32 21.025 26.275 27.025 25.674999999999997 33 20.05 25.95 27.525 26.474999999999998 34 20.3 26.400000000000002 27.3 26.0 35 21.625 24.45 27.775 26.150000000000002 36 19.900000000000002 25.25 28.299999999999997 26.55 37 22.125 25.6 25.825 26.450000000000003 38 21.85 25.45 27.750000000000004 24.95 39 20.974999999999998 23.95 28.125 26.950000000000003 40 21.65 25.525 27.125 25.7 41 22.3 24.875 26.174999999999997 26.650000000000002 42 20.775 24.375 26.900000000000002 27.950000000000003 43 21.95 25.650000000000002 26.724999999999998 25.674999999999997 44 21.475 25.424999999999997 28.249999999999996 24.85 45 20.275000000000002 24.925 27.450000000000003 27.35 46 20.080020005001252 25.006251562890725 27.081770442610654 27.831957989497376 47 20.180045011252815 26.556639159789945 27.406851712928233 25.85646411602901 48 21.73043260815204 25.206301575393848 25.78144536134033 27.28182045511378 49 22.075 25.074999999999996 25.900000000000002 26.950000000000003 50 21.230307576894223 25.756439109777446 26.38159539884971 26.63165791447862 51 20.575 24.8 27.85 26.775 52 22.475 25.775 24.675 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 2.5 21 5.0 22 4.5 23 4.0 24 11.0 25 18.0 26 16.0 27 14.0 28 14.0 29 14.0 30 25.0 31 36.0 32 53.0 33 70.0 34 82.5 35 95.0 36 123.0 37 151.0 38 170.0 39 213.5 40 238.0 41 266.0 42 294.0 43 314.0 44 334.0 45 357.0 46 380.0 47 395.5 48 411.0 49 380.0 50 349.0 51 344.0 52 339.0 53 328.5 54 318.0 55 283.5 56 249.0 57 216.0 58 183.0 59 144.5 60 106.0 61 93.0 62 80.0 63 61.5 64 36.5 65 30.0 66 26.5 67 23.0 68 15.5 69 8.0 70 8.5 71 9.0 72 5.5 73 2.0 74 2.0 75 2.0 76 1.5 77 1.0 78 2.0 79 3.0 80 2.0 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.025 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.025 47 0.025 48 0.025 49 0.0 50 0.025 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5542957923910304 1.0999999999999999 3 0.02519526329050139 0.075 4 0.02519526329050139 0.1 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCAGTTTTGCCAAGCAGCCCGAGCCTTTTGGTGTAAGCTGCCAGACGGGCC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra Read 200000 spots for SRR5423570.sra Written 200000 spots for SRR5423570.sra SRR ids: ['SRR5423570.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vuhh2io5 SRR5423570.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423570 file size 703971 SRR5423570 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423570 SRR5423570_1.fastq Input file: SRR5423570_1.fastq trimmed: SRR5423570-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:36:30 2025 >> started Thu Feb 13 14:36:32 2025 >> done (1.848s) 4000000 reads processed; of these: 271 ( 0.01%) short reads filtered out after trimming by size control 369 ( 0.01%) empty reads filtered out after trimming by size control 3999360 (99.98%) reads available; of these: 51316 ( 1.28%) trimmed reads available after processing 3948044 (98.72%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 11 0.00% 20 9 0.00% 21 0 0.00% 22 2 0.00% 23 1 0.00% 24 5 0.00% 25 1 0.00% 26 10 0.00% 27 3 0.00% 28 6 0.00% 29 9 0.00% 30 9 0.00% 31 10 0.00% 32 16 0.00% 33 27 0.00% 34 25 0.00% 35 22 0.00% 36 45 0.00% 37 31 0.00% 38 57 0.00% 39 57 0.00% 40 64 0.00% 41 79 0.00% 42 108 0.00% 43 139 0.00% 44 188 0.00% 45 278 0.01% 46 436 0.01% 47 593 0.01% 48 1017 0.03% 49 2072 0.05% 50 5866 0.15% 51 40108 1.00% 52 3948044 98.72% 3999360 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=23 fanout-score=201.82 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=22.0 sequence=CTTCTTCTTCTC Started job on | Feb 13 14:36:43 Started mapping on | Feb 13 14:36:43 Finished on | Feb 13 14:36:48 Mapping speed, Million of reads per hour | 2879.54 Number of input reads | 3999360 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3662183 Uniquely mapped reads % | 91.57% Average mapped length | 51.82 Number of splices: Total | 484457 Number of splices: Annotated (sjdb) | 476707 Number of splices: GT/AG | 477948 Number of splices: GC/AG | 5636 Number of splices: AT/AC | 368 Number of splices: Non-canonical | 505 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.42 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 265074 % of reads mapped to multiple loci | 6.63% Number of reads mapped to too many loci | 43063 % of reads mapped to too many loci | 1.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.72% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 72103 72103 72103 N_multimapping 265074 265074 265074 N_noFeature 128677 3630084 143048 N_ambiguous 28929 77 11159 UnstrandedReadsAssigned:3504577 PositiveStrandReadsAssigned:32022 NegativeStrandReadsAssigned:3507976 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423570 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423570-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,360 reads, 3,673,286 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,121 rounds 52401 SRR5423570.ke.tsv 34699 SRR5423570.se.tsv 87100 total ==> SRR5423570.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 164 27.039 Potri.005G024800.1.v4.1 1035 936 21 7.09847 Potri.004G059700.1.v4.1 961 862 18 6.60673 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 61.0945 6.79663 Potri.016G087400.1.v4.1 270 171 151 279.384 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 10 1.89002 Potri.012G127500.1.v4.1 977 878 1878 676.74 ==> SRR5423570.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 119 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR5423570 completed mapping pipeline successfully