Starting /dee2/code/volunteer_pipeline.sh SRR5423571 current disk space = 3089338097664 free memory = 1451514736 SRR5423571 SRAfilesize 488d1e369b91756bf48f8ac0961bea36 SRR5423571.sra SRR5423571.sra file validated SRR5423571 is single end SRR5423571 is conventional basespace SRR5423571 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423571_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.272 31.0 31.0 34.0 28.0 34.0 2 31.74275 33.0 31.0 34.0 30.0 34.0 3 32.04525 34.0 31.0 34.0 30.0 34.0 4 31.83 35.0 30.0 37.0 19.0 37.0 5 34.4165 35.0 35.0 37.0 28.0 37.0 6 35.27375 37.0 35.0 37.0 32.0 37.0 7 35.673 37.0 35.0 37.0 33.0 37.0 8 35.75275 37.0 35.0 37.0 35.0 37.0 9 37.60475 39.0 37.0 39.0 35.0 39.0 10 37.39675 39.0 37.0 39.0 35.0 39.0 11 37.47275 39.0 37.0 39.0 34.0 39.0 12 37.45725 39.0 37.0 39.0 34.0 39.0 13 37.478 39.0 37.0 39.0 35.0 39.0 14 38.85675 40.0 38.0 41.0 35.0 41.0 15 38.79275 40.0 38.0 41.0 35.0 41.0 16 38.81425 40.0 38.0 41.0 35.0 41.0 17 38.72525 40.0 38.0 41.0 34.0 41.0 18 38.777 40.0 38.0 41.0 35.0 41.0 19 38.74025 40.0 38.0 41.0 34.0 41.0 20 38.829 40.0 38.0 41.0 34.0 41.0 21 38.7125 40.0 38.0 41.0 34.0 41.0 22 38.71075 40.0 38.0 41.0 34.0 41.0 23 38.809 40.0 38.0 41.0 35.0 41.0 24 38.88425 40.0 38.0 41.0 35.0 41.0 25 38.81575 40.0 38.0 41.0 35.0 41.0 26 38.727 40.0 38.0 41.0 34.0 41.0 27 38.607 40.0 38.0 41.0 34.0 41.0 28 38.66275 40.0 38.0 41.0 35.0 41.0 29 38.426 40.0 38.0 41.0 34.0 41.0 30 38.64075 40.0 38.0 41.0 34.0 41.0 31 38.6225 40.0 38.0 41.0 35.0 41.0 32 38.489 40.0 38.0 41.0 34.0 41.0 33 38.52975 40.0 38.0 41.0 34.0 41.0 34 38.5275 40.0 38.0 41.0 34.0 41.0 35 38.45375 40.0 38.0 41.0 34.0 41.0 36 38.39825 40.0 38.0 41.0 34.0 41.0 37 38.4125 40.0 38.0 41.0 34.0 41.0 38 38.33675 40.0 38.0 41.0 34.0 41.0 39 38.30975 40.0 38.0 41.0 34.0 41.0 40 38.21825 40.0 38.0 41.0 34.0 41.0 41 38.12425 40.0 38.0 41.0 33.0 41.0 42 38.02175 40.0 38.0 41.0 33.0 41.0 43 37.94575 40.0 37.0 41.0 33.0 41.0 44 37.9935 40.0 37.0 41.0 33.0 41.0 45 37.90475 40.0 37.0 41.0 33.0 41.0 46 37.8695 40.0 37.0 41.0 33.0 41.0 47 38.06175 40.0 37.0 41.0 33.0 41.0 48 37.8155 40.0 37.0 41.0 33.0 41.0 49 37.814 40.0 37.0 41.0 33.0 41.0 50 37.853 40.0 37.0 41.0 33.0 41.0 51 37.85625 40.0 37.0 41.0 33.0 41.0 52 36.86 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2312 1 0.0 2312 2 0.0 2312 3 0.0 2312 4 0.0 2312 5 0.0 2312 6 0.0 2312 7 0.0 2312 8 0.0 2312 9 0.0 2312 10 0.0 2312 11 0.0 2312 12 0.0 2312 13 0.0 2312 14 0.0 2312 15 0.0 2312 16 0.0 2312 17 0.0 2312 18 0.0 2312 19 0.0 2312 20 0.0 2312 21 0.0 2312 22 0.0 2312 23 0.0 2312 24 0.0 2312 25 0.0 2312 26 0.0 2312 27 0.0 2312 28 0.0 2312 29 0.0 2312 30 0.0 2312 31 0.0 2312 32 0.0 2312 33 0.0 2312 34 0.0 2312 35 0.0 2312 36 0.0 2312 37 0.0 2312 38 0.0 2312 39 0.0 2312 40 0.0 2312 41 0.0 2312 42 0.0 2312 43 0.0 2312 44 0.0 2312 45 0.0 2312 46 0.0 2312 47 0.0 2312 48 0.0 2312 49 0.0 2312 50 0.0 2312 51 0.0 2312 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 4.0 25 10.0 26 15.0 27 21.0 28 26.0 29 37.0 30 45.0 31 65.0 32 94.0 33 103.0 34 146.0 35 218.0 36 291.0 37 456.0 38 861.0 39 1595.0 40 6.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.20955238809702 11.602900725181295 6.826706676669167 43.360840210052515 2 22.400000000000002 15.25 36.175000000000004 26.174999999999997 3 21.25 18.55 23.575 36.625 4 24.099999999999998 25.4 23.674999999999997 26.825 5 25.025 30.125 24.5 20.349999999999998 6 18.375 33.825 23.799999999999997 24.0 7 14.000000000000002 23.400000000000002 42.25 20.349999999999998 8 16.3 21.975 32.45 29.275000000000002 9 17.25 20.724999999999998 34.625 27.400000000000002 10 18.625 35.949999999999996 25.074999999999996 20.349999999999998 11 22.925 27.85 22.75 26.474999999999998 12 21.725 22.275 28.199999999999996 27.800000000000004 13 19.275000000000002 26.25 28.175 26.3 14 19.775000000000002 26.900000000000002 28.599999999999998 24.725 15 19.900000000000002 26.05 27.450000000000003 26.6 16 20.575 26.0 27.400000000000002 26.025 17 20.225 27.200000000000003 27.950000000000003 24.625 18 21.275 25.874999999999996 25.974999999999998 26.875 19 20.45 27.325 26.25 25.974999999999998 20 21.099999999999998 26.625 26.400000000000002 25.874999999999996 21 21.025 24.85 27.775 26.35 22 21.8 25.174999999999997 26.35 26.674999999999997 23 20.75 25.95 28.925 24.375 24 20.474999999999998 26.075 26.85 26.6 25 21.05 25.3 26.575 27.075 26 19.900000000000002 25.8 28.4 25.900000000000002 27 20.849999999999998 24.175 27.750000000000004 27.224999999999998 28 20.775 26.474999999999998 27.025 25.724999999999998 29 20.549999999999997 25.75 28.000000000000004 25.7 30 20.974999999999998 25.5 26.724999999999998 26.8 31 21.05 25.8 26.625 26.525 32 20.1 26.900000000000002 26.900000000000002 26.1 33 21.3 25.15 27.075 26.474999999999998 34 21.725 25.75 27.175 25.35 35 21.775 25.3 27.1 25.825 36 20.349999999999998 24.875 28.125 26.650000000000002 37 20.875 26.25 26.650000000000002 26.224999999999998 38 21.125 26.200000000000003 27.224999999999998 25.45 39 20.775 25.7 26.0 27.525 40 20.8 27.400000000000002 25.85 25.95 41 20.724999999999998 26.125 26.974999999999998 26.174999999999997 42 20.95 25.724999999999998 27.150000000000002 26.174999999999997 43 21.9 25.224999999999998 25.95 26.924999999999997 44 20.925 25.95 27.05 26.075 45 22.175 24.65 26.950000000000003 26.224999999999998 46 20.95 24.675 26.325 28.050000000000004 47 21.425 25.525 26.174999999999997 26.875 48 21.275 26.6 26.85 25.275 49 21.525 26.0 26.0 26.474999999999998 50 21.9 25.2 27.175 25.724999999999998 51 22.325 23.974999999999998 26.125 27.575 52 21.325 26.05 25.900000000000002 26.724999999999998 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 5.0 20 3.5 21 2.0 22 4.5 23 7.0 24 7.0 25 7.0 26 10.0 27 13.0 28 20.5 29 28.0 30 38.0 31 48.0 32 60.5 33 73.0 34 84.5 35 96.0 36 120.0 37 144.0 38 166.5 39 227.0 40 265.0 41 276.5 42 288.0 43 303.0 44 318.0 45 333.5 46 349.0 47 365.5 48 382.0 49 400.0 50 418.0 51 381.5 52 345.0 53 324.5 54 304.0 55 267.5 56 231.0 57 196.5 58 162.0 59 131.5 60 101.0 61 98.0 62 95.0 63 71.5 64 38.5 65 29.0 66 26.5 67 24.0 68 15.0 69 6.0 70 8.0 71 10.0 72 6.0 73 2.0 74 4.5 75 7.0 76 4.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3193849256365 98.5 2 0.5797832114948324 1.15 3 0.050415931434333254 0.15 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83848 spots for SRR5423571.sra Written 83848 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra Read 83830 spots for SRR5423571.sra Written 83830 spots for SRR5423571.sra SRR ids: ['SRR5423571.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gvops4_5 SRR5423571.sra spots: 1676618 blocks: [[1, 83830], [83831, 167660], [167661, 251490], [251491, 335320], [335321, 419150], [419151, 502980], [502981, 586810], [586811, 670640], [670641, 754470], [754471, 838300], [838301, 922130], [922131, 1005960], [1005961, 1089790], [1089791, 1173620], [1173621, 1257450], [1257451, 1341280], [1341281, 1425110], [1425111, 1508940], [1508941, 1592770], [1592771, 1676618]] SRR5423571 file size 294463 SRR5423571 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423571 SRR5423571_1.fastq Input file: SRR5423571_1.fastq trimmed: SRR5423571-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:51:32 2025 >> started Thu Feb 13 14:51:33 2025 >> done (0.879s) 1676618 reads processed; of these: 133 ( 0.01%) short reads filtered out after trimming by size control 196 ( 0.01%) empty reads filtered out after trimming by size control 1676289 (99.98%) reads available; of these: 18967 ( 1.13%) trimmed reads available after processing 1657322 (98.87%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 8 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 2 0.00% 26 2 0.00% 27 2 0.00% 28 1 0.00% 29 2 0.00% 30 1 0.00% 31 2 0.00% 32 6 0.00% 33 5 0.00% 34 4 0.00% 35 5 0.00% 36 6 0.00% 37 12 0.00% 38 5 0.00% 39 14 0.00% 40 17 0.00% 41 15 0.00% 42 19 0.00% 43 28 0.00% 44 48 0.00% 45 62 0.00% 46 92 0.01% 47 143 0.01% 48 244 0.01% 49 644 0.04% 50 2126 0.13% 51 15445 0.92% 52 1657322 98.87% 1676289 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=31 prefix-density=0.18 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=158.54 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=23.2 sequence=TTCTTCTTCTTGTC Started job on | Feb 13 14:51:46 Started mapping on | Feb 13 14:51:46 Finished on | Feb 13 14:51:49 Mapping speed, Million of reads per hour | 2011.55 Number of input reads | 1676289 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 1535317 Uniquely mapped reads % | 91.59% Average mapped length | 51.82 Number of splices: Total | 202407 Number of splices: Annotated (sjdb) | 199110 Number of splices: GT/AG | 199640 Number of splices: GC/AG | 2417 Number of splices: AT/AC | 148 Number of splices: Non-canonical | 202 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 110869 % of reads mapped to multiple loci | 6.61% Number of reads mapped to too many loci | 18428 % of reads mapped to too many loci | 1.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.69% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 30103 30103 30103 N_multimapping 110869 110869 110869 N_noFeature 54382 1521832 60359 N_ambiguous 12283 34 4761 UnstrandedReadsAssigned:1468652 PositiveStrandReadsAssigned:13451 NegativeStrandReadsAssigned:1470197 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423571 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423571-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 1,676,289 reads, 1,538,004 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,035 rounds 52401 SRR5423571.ke.tsv 34699 SRR5423571.se.tsv 87100 total ==> SRR5423571.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 78 30.7252 Potri.005G024800.1.v4.1 1035 936 14.0104 11.3149 Potri.004G059700.1.v4.1 961 862 4 3.50775 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 28.1834 7.491 Potri.016G087400.1.v4.1 270 171 57 251.973 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 4 1.80626 Potri.012G127500.1.v4.1 977 878 763 656.91 ==> SRR5423571.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 53 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 13 SRR5423571 completed mapping pipeline successfully