Starting /dee2/code/volunteer_pipeline.sh SRR5423572 current disk space = 3089517809664 free memory = 1449804472 SRR5423572 SRAfilesize 6a6c7331bf63bf7207763b1aa77092b8 SRR5423572.sra SRR5423572.sra file validated SRR5423572 is single end SRR5423572 is conventional basespace SRR5423572 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423572_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.4555 33.0 32.0 34.0 2.0 34.0 2 31.5655 33.0 31.0 34.0 27.0 34.0 3 31.691 33.0 32.0 34.0 27.0 34.0 4 31.48225 33.0 32.0 34.0 27.0 34.0 5 32.00375 33.0 32.0 34.0 30.0 34.0 6 35.4295 38.0 36.0 38.0 29.0 38.0 7 35.746 38.0 36.0 38.0 31.0 38.0 8 35.889 38.0 37.0 38.0 31.0 38.0 9 35.96325 38.0 37.0 38.0 31.0 38.0 10 36.14075 38.0 37.0 38.0 33.0 38.0 11 36.3275 38.0 37.0 38.0 33.0 38.0 12 36.16225 38.0 37.0 38.0 33.0 38.0 13 35.897 38.0 37.0 38.0 31.0 38.0 14 36.019 38.0 37.0 38.0 31.0 38.0 15 35.55825 38.0 36.0 38.0 29.0 38.0 16 36.07575 38.0 37.0 38.0 31.0 38.0 17 36.19825 38.0 37.0 38.0 33.0 38.0 18 35.97925 38.0 37.0 38.0 33.0 38.0 19 35.8675 38.0 37.0 38.0 31.0 38.0 20 36.227 38.0 37.0 38.0 33.0 38.0 21 36.246 38.0 37.0 38.0 33.0 38.0 22 36.414 38.0 37.0 38.0 33.0 38.0 23 36.17625 38.0 37.0 38.0 33.0 38.0 24 36.32125 38.0 37.0 38.0 33.0 38.0 25 36.308 38.0 37.0 38.0 33.0 38.0 26 36.40375 38.0 37.0 38.0 34.0 38.0 27 36.28075 38.0 37.0 38.0 33.0 38.0 28 36.33425 38.0 37.0 38.0 33.0 38.0 29 36.4205 38.0 38.0 38.0 34.0 38.0 30 36.4035 38.0 37.0 38.0 34.0 38.0 31 36.4975 38.0 38.0 38.0 34.0 38.0 32 36.54875 38.0 38.0 38.0 34.0 38.0 33 36.4365 38.0 37.0 38.0 34.0 38.0 34 36.53925 38.0 38.0 38.0 34.0 38.0 35 36.267 38.0 37.0 38.0 33.0 38.0 36 36.16725 38.0 37.0 38.0 33.0 38.0 37 36.1935 38.0 37.0 38.0 33.0 38.0 38 36.5265 38.0 38.0 38.0 34.0 38.0 39 36.37075 38.0 38.0 38.0 34.0 38.0 40 36.29675 38.0 38.0 38.0 33.0 38.0 41 36.237 38.0 37.0 38.0 33.0 38.0 42 36.3595 38.0 37.0 38.0 34.0 38.0 43 36.489 38.0 38.0 38.0 34.0 38.0 44 36.5565 38.0 38.0 38.0 34.0 38.0 45 36.3275 38.0 38.0 38.0 33.0 38.0 46 36.318 38.0 38.0 38.0 33.0 38.0 47 36.45975 38.0 38.0 38.0 34.0 38.0 48 36.436 38.0 38.0 38.0 34.0 38.0 49 36.42175 38.0 37.0 38.0 33.0 38.0 50 36.46025 38.0 38.0 38.0 34.0 38.0 51 36.3535 38.0 37.0 38.0 33.0 38.0 52 35.99425 38.0 37.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 3.0 23 0.0 24 2.0 25 6.0 26 14.0 27 35.0 28 49.0 29 58.0 30 74.0 31 123.0 32 148.0 33 212.0 34 287.0 35 431.0 36 951.0 37 1607.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.973597359735976 11.581158115811581 7.920792079207921 44.52445244524452 2 21.75 16.725 34.875 26.650000000000002 3 22.650000000000002 17.474999999999998 23.075000000000003 36.8 4 25.174999999999997 25.7 22.3 26.825 5 25.05 30.5 24.2 20.25 6 19.55 32.725 23.549999999999997 24.175 7 14.025000000000002 24.05 41.8 20.125 8 17.175 22.2 32.2 28.425 9 18.875 21.75 32.574999999999996 26.8 10 18.775 36.85 24.425 19.950000000000003 11 23.849999999999998 26.0 22.325 27.825 12 21.0 23.474999999999998 26.924999999999997 28.599999999999998 13 19.825 25.324999999999996 28.449999999999996 26.400000000000002 14 20.424999999999997 25.75 28.975 24.85 15 20.625 25.025 27.85 26.5 16 21.3 27.575 26.625 24.5 17 21.875 25.75 26.700000000000003 25.674999999999997 18 21.3 25.874999999999996 26.525 26.3 19 20.549999999999997 26.85 28.15 24.45 20 22.35 25.124999999999996 26.700000000000003 25.825 21 20.5 26.85 27.825 24.825 22 21.099999999999998 26.35 27.775 24.775 23 21.75 25.15 26.424999999999997 26.674999999999997 24 20.65 24.875 27.6 26.875 25 21.25 26.825 26.174999999999997 25.75 26 21.25 25.5 27.925 25.324999999999996 27 20.325 25.974999999999998 27.55 26.150000000000002 28 19.575 25.900000000000002 27.975 26.55 29 21.075 25.85 26.85 26.224999999999998 30 21.075 25.124999999999996 26.85 26.950000000000003 31 21.25 26.325 26.8 25.624999999999996 32 21.95 26.325 26.474999999999998 25.25 33 20.125 25.025 28.549999999999997 26.3 34 20.474999999999998 25.825 27.800000000000004 25.900000000000002 35 21.825 25.674999999999997 27.025 25.474999999999998 36 20.175 25.4 28.525 25.900000000000002 37 20.5 25.85 25.25 28.4 38 19.85 26.900000000000002 28.475 24.775 39 21.175 25.0 26.55 27.275 40 20.974999999999998 26.5 26.674999999999997 25.85 41 20.4 25.424999999999997 27.975 26.200000000000003 42 21.349999999999998 25.374999999999996 26.5 26.775 43 21.5 25.074999999999996 27.35 26.075 44 21.275 26.075 26.375 26.275 45 21.6 25.3 27.125 25.974999999999998 46 21.15 25.275 26.8 26.775 47 20.8 26.375 26.700000000000003 26.125 48 22.35 23.5 27.425 26.724999999999998 49 20.075000000000003 25.8 27.500000000000004 26.625 50 21.95 24.3 27.975 25.775 51 21.075 25.224999999999998 26.875 26.825 52 20.05 24.8 26.700000000000003 28.449999999999996 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 2.0 18 2.5 19 3.0 20 3.5 21 4.0 22 2.5 23 1.0 24 5.5 25 10.0 26 16.0 27 22.0 28 27.5 29 33.0 30 39.5 31 46.0 32 63.0 33 80.0 34 85.5 35 91.0 36 122.0 37 153.0 38 161.5 39 208.5 40 247.0 41 267.5 42 288.0 43 338.5 44 389.0 45 395.0 46 401.0 47 380.5 48 360.0 49 363.5 50 367.0 51 359.5 52 352.0 53 335.5 54 319.0 55 267.0 56 215.0 57 183.5 58 152.0 59 130.5 60 109.0 61 89.5 62 70.0 63 55.0 64 34.0 65 28.0 66 21.0 67 14.0 68 13.5 69 13.0 70 8.5 71 4.0 72 9.0 73 14.0 74 7.5 75 1.0 76 1.0 77 1.0 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 16.675 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62358845671268 99.25 2 0.37641154328732745 0.75 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.05 0.0 0.0 0.0 0.0 25 0.05 0.0 0.0 0.0 0.0 26 0.05 0.0 0.0 0.0 0.0 27 0.05 0.0 0.0 0.0 0.0 28 0.05 0.0 0.0 0.0 0.0 29 0.05 0.0 0.0 0.0 0.0 30 0.05 0.0 0.0 0.0 0.0 31 0.05 0.0 0.0 0.0 0.0 32 0.05 0.0 0.0 0.0 0.0 33 0.05 0.0 0.0 0.0 0.0 34 0.05 0.0 0.0 0.0 0.0 35 0.05 0.0 0.0 0.0 0.0 36 0.05 0.0 0.0 0.0 0.0 37 0.05 0.0 0.0 0.0 0.0 38 0.05 0.0 0.0 0.0 0.0 39 0.05 0.0 0.0 0.0 0.0 40 0.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra Read 1532491 spots for SRR5423572.sra Written 1532491 spots for SRR5423572.sra Read 1532489 spots for SRR5423572.sra Written 1532489 spots for SRR5423572.sra SRR ids: ['SRR5423572.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bm8iwyff SRR5423572.sra spots: 30649782 blocks: [[1, 1532489], [1532490, 3064978], [3064979, 4597467], [4597468, 6129956], [6129957, 7662445], [7662446, 9194934], [9194935, 10727423], [10727424, 12259912], [12259913, 13792401], [13792402, 15324890], [15324891, 16857379], [16857380, 18389868], [18389869, 19922357], [19922358, 21454846], [21454847, 22987335], [22987336, 24519824], [24519825, 26052313], [26052314, 27584802], [27584803, 29117291], [29117292, 30649782]] SRR5423572 file size 5331620 SRR5423572 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423572 SRR5423572_1.fastq Input file: SRR5423572_1.fastq trimmed: SRR5423572-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:39:31 2025 >> started Thu Feb 13 14:39:52 2025 >> done (20.415s) 30649782 reads processed; of these: 2492 ( 0.01%) short reads filtered out after trimming by size control 3680 ( 0.01%) empty reads filtered out after trimming by size control 30643610 (99.98%) reads available; of these: 2463 ( 0.01%) trimmed reads available after processing 30641147 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 57 0.00% 19 80 0.00% 20 42 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 2284 0.01% 52 30641147 99.99% 30643610 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.0 sequence=TTATTGGAGGAGTCACTGGAGGCTTTGGTGGTGGAAGAGTTGGTGGTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=186.80 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=23.0 sequence=CTTCTTCTTCTT Started job on | Feb 13 14:40:06 Started mapping on | Feb 13 14:40:06 Finished on | Feb 13 14:40:40 Mapping speed, Million of reads per hour | 3244.62 Number of input reads | 30643610 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 28013866 Uniquely mapped reads % | 91.42% Average mapped length | 51.82 Number of splices: Total | 3736443 Number of splices: Annotated (sjdb) | 3678109 Number of splices: GT/AG | 3686330 Number of splices: GC/AG | 43771 Number of splices: AT/AC | 2698 Number of splices: Non-canonical | 3644 Mismatch rate per base, % | 0.52% Deletion rate per base | 0.01% Deletion average length | 1.62 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2010012 % of reads mapped to multiple loci | 6.56% Number of reads mapped to too many loci | 348775 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.88% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 619732 619732 619732 N_multimapping 2010012 2010012 2010012 N_noFeature 991556 27774480 1091987 N_ambiguous 222813 526 83617 UnstrandedReadsAssigned:26799497 PositiveStrandReadsAssigned:238860 NegativeStrandReadsAssigned:26838262 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423572 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423572-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,643,610 reads, 27,146,155 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,319 rounds 52401 SRR5423572.ke.tsv 34699 SRR5423572.se.tsv 87100 total ==> SRR5423572.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 1360.16 30.3618 Potri.005G024800.1.v4.1 1035 936 231.18 10.58 Potri.004G059700.1.v4.1 961 862 108.63 5.39827 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 533.023 8.02838 Potri.016G087400.1.v4.1 270 171 1285 321.898 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 124.616 3.18882 Potri.012G127500.1.v4.1 977 878 14041 685.039 ==> SRR5423572.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 117 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 858 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 237 SRR5423572 completed mapping pipeline successfully