Starting /dee2/code/volunteer_pipeline.sh SRR5423573 current disk space = 3089294548992 free memory = 1418118228 SRR5423573 SRAfilesize af5c9467e6eac66aada8b343c69c304e SRR5423573.sra SRR5423573.sra file validated SRR5423573 is single end SRR5423573 is conventional basespace SRR5423573 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423573_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.24925 34.0 31.0 34.0 27.0 34.0 2 31.604 34.0 31.0 34.0 27.0 34.0 3 32.576 34.0 31.0 34.0 30.0 34.0 4 36.16375 37.0 35.0 37.0 35.0 37.0 5 36.06 37.0 37.0 37.0 35.0 37.0 6 36.245 37.0 37.0 37.0 35.0 37.0 7 36.247 37.0 37.0 37.0 35.0 37.0 8 36.21275 37.0 37.0 37.0 35.0 37.0 9 37.9175 39.0 38.0 39.0 35.0 39.0 10 38.05075 39.0 38.0 39.0 35.0 39.0 11 38.12825 39.0 39.0 39.0 37.0 39.0 12 38.08425 39.0 39.0 39.0 35.0 39.0 13 37.99625 39.0 38.0 39.0 35.0 39.0 14 39.576 41.0 40.0 41.0 37.0 41.0 15 39.488 41.0 39.0 41.0 36.0 41.0 16 39.40375 41.0 39.0 41.0 36.0 41.0 17 39.323 41.0 39.0 41.0 36.0 41.0 18 39.4255 41.0 39.0 41.0 36.0 41.0 19 39.395 41.0 39.0 41.0 36.0 41.0 20 39.52875 41.0 39.0 41.0 37.0 41.0 21 39.3895 41.0 39.0 41.0 36.0 41.0 22 39.423 41.0 39.0 41.0 37.0 41.0 23 39.34025 41.0 39.0 41.0 36.0 41.0 24 39.3315 41.0 39.0 41.0 36.0 41.0 25 39.33875 41.0 39.0 41.0 36.0 41.0 26 39.316 41.0 39.0 41.0 36.0 41.0 27 39.35475 41.0 39.0 41.0 37.0 41.0 28 39.20175 41.0 39.0 41.0 36.0 41.0 29 39.232 41.0 39.0 41.0 36.0 41.0 30 39.21275 41.0 39.0 41.0 36.0 41.0 31 39.1545 41.0 39.0 41.0 36.0 41.0 32 39.07175 40.0 39.0 41.0 36.0 41.0 33 39.04825 40.0 39.0 41.0 36.0 41.0 34 39.05425 40.0 39.0 41.0 36.0 41.0 35 38.959 40.0 39.0 41.0 35.0 41.0 36 38.811 40.0 38.0 41.0 35.0 41.0 37 38.818 40.0 38.0 41.0 35.0 41.0 38 38.72725 40.0 38.0 41.0 35.0 41.0 39 38.765 40.0 38.0 41.0 35.0 41.0 40 38.69625 40.0 38.0 41.0 35.0 41.0 41 38.60725 40.0 38.0 41.0 34.0 41.0 42 38.5035 40.0 38.0 41.0 34.0 41.0 43 38.477 40.0 38.0 41.0 34.0 41.0 44 38.3465 40.0 38.0 41.0 34.0 41.0 45 38.1995 40.0 38.0 41.0 33.0 41.0 46 38.209 40.0 38.0 41.0 33.0 41.0 47 38.078 40.0 38.0 41.0 33.0 41.0 48 38.147 40.0 38.0 41.0 33.0 41.0 49 38.0165 40.0 38.0 41.0 33.0 41.0 50 37.86625 40.0 37.0 41.0 33.0 41.0 51 37.77625 40.0 37.0 41.0 33.0 41.0 52 36.0385 38.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1101 1 0.0 1101 2 0.0 1101 3 0.0 1101 4 0.0 1101 5 0.0 1101 6 0.0 1101 7 0.0 1101 8 0.0 1101 9 0.0 1101 10 0.0 1101 11 0.0 1101 12 0.0 1101 13 0.0 1101 14 0.0 1101 15 0.0 1101 16 0.0 1101 17 0.0 1101 18 0.0 1101 19 0.0 1101 20 0.0 1101 21 0.0 1101 22 0.0 1101 23 0.0 1101 24 0.0 1101 25 0.0 1101 26 0.0 1101 27 0.0 1101 28 0.0 1101 29 0.0 1101 30 0.0 1101 31 0.0 1101 32 0.0 1101 33 0.0 1101 34 0.0 1101 35 0.0 1101 36 0.0 1101 37 0.0 1101 38 0.0 1101 39 0.0 1101 40 0.0 1101 41 0.0 1101 42 0.0 1101 43 0.0 1101 44 0.0 1101 45 0.0 1101 46 0.0 1101 47 0.0 1101 48 0.0 1101 49 0.0 1101 50 0.0 1101 51 0.0 1101 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 1.0 20 0.0 21 1.0 22 1.0 23 3.0 24 7.0 25 9.0 26 10.0 27 12.0 28 23.0 29 20.0 30 25.0 31 36.0 32 65.0 33 77.0 34 100.0 35 157.0 36 254.0 37 377.0 38 775.0 39 2037.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.54644808743169 11.530054644808743 6.857923497267759 46.0655737704918 2 21.9 14.575 35.699999999999996 27.825 3 21.25 17.675 23.75 37.325 4 23.575 26.325 23.5 26.6 5 23.849999999999998 30.925000000000004 24.349999999999998 20.875 6 18.75 31.55 24.825 24.875 7 15.375 22.925 41.975 19.725 8 17.150000000000002 21.8 32.025 29.025000000000002 9 18.0 20.925 33.6 27.474999999999998 10 17.724999999999998 36.65 25.15 20.474999999999998 11 22.15 25.525 23.05 29.275000000000002 12 21.725 23.45 27.700000000000003 27.125 13 20.375 25.825 27.775 26.025 14 19.75 26.825 29.075 24.349999999999998 15 21.175 24.575 26.174999999999997 28.075 16 20.349999999999998 26.775 27.0 25.874999999999996 17 19.875 27.3 27.3 25.525 18 20.8 25.5 26.424999999999997 27.275 19 19.875 27.150000000000002 27.200000000000003 25.775 20 20.875 25.025 28.749999999999996 25.35 21 20.849999999999998 25.5 27.700000000000003 25.95 22 20.05 27.250000000000004 25.924999999999997 26.775 23 20.0 26.075 27.750000000000004 26.174999999999997 24 20.3 24.75 27.325 27.625 25 21.15 25.575 27.200000000000003 26.075 26 20.474999999999998 26.174999999999997 27.800000000000004 25.55 27 20.775 24.975 28.025 26.224999999999998 28 20.7 27.224999999999998 26.8 25.275 29 20.424999999999997 26.424999999999997 27.775 25.374999999999996 30 20.424999999999997 25.525 26.55 27.500000000000004 31 19.825 26.325 27.3 26.55 32 21.45 25.224999999999998 26.650000000000002 26.674999999999997 33 20.45 25.5 27.250000000000004 26.8 34 20.875 25.624999999999996 27.500000000000004 26.0 35 20.474999999999998 26.400000000000002 26.55 26.575 36 21.175 26.1 26.5 26.224999999999998 37 20.3 26.650000000000002 26.450000000000003 26.6 38 20.575 25.624999999999996 26.875 26.924999999999997 39 21.175 24.55 25.674999999999997 28.599999999999998 40 21.25 25.4 27.125 26.224999999999998 41 22.0 25.124999999999996 26.400000000000002 26.474999999999998 42 19.650000000000002 24.925 26.724999999999998 28.7 43 21.025 26.6 26.3 26.075 44 21.7 25.674999999999997 27.250000000000004 25.374999999999996 45 20.125 25.55 27.625 26.700000000000003 46 20.724999999999998 24.675 28.125 26.474999999999998 47 19.625 25.8 27.275 27.3 48 21.224999999999998 24.6 27.05 27.125 49 21.85 25.474999999999998 26.174999999999997 26.5 50 21.099999999999998 26.450000000000003 25.474999999999998 26.974999999999998 51 21.725 24.825 26.6 26.85 52 20.974999999999998 25.15 26.424999999999997 27.450000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 1.5 17 2.0 18 1.5 19 1.0 20 3.5 21 6.0 22 6.5 23 7.0 24 5.5 25 4.0 26 6.5 27 9.0 28 25.0 29 41.0 30 43.5 31 46.0 32 60.5 33 75.0 34 80.0 35 85.0 36 115.0 37 145.0 38 171.5 39 233.0 40 268.0 41 277.0 42 286.0 43 317.0 44 348.0 45 358.5 46 369.0 47 375.5 48 382.0 49 369.5 50 357.0 51 359.5 52 362.0 53 333.0 54 304.0 55 261.0 56 218.0 57 175.0 58 132.0 59 132.5 60 133.0 61 109.0 62 85.0 63 67.5 64 37.0 65 24.0 66 23.0 67 22.0 68 19.0 69 16.0 70 11.0 71 6.0 72 6.0 73 6.0 74 5.5 75 5.0 76 4.0 77 3.0 78 2.0 79 1.0 80 1.0 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19253091092607 98.275 2 0.7065354529396921 1.4000000000000001 3 0.0757002271006813 0.22499999999999998 4 0.025233409033560434 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra Read 200000 spots for SRR5423573.sra Written 200000 spots for SRR5423573.sra SRR ids: ['SRR5423573.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__k1e4oba SRR5423573.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423573 file size 703956 SRR5423573 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423573 SRR5423573_1.fastq Input file: SRR5423573_1.fastq trimmed: SRR5423573-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 14:54:57 2025 >> started Thu Feb 13 14:54:59 2025 >> done (1.983s) 4000000 reads processed; of these: 213 ( 0.01%) short reads filtered out after trimming by size control 358 ( 0.01%) empty reads filtered out after trimming by size control 3999429 (99.99%) reads available; of these: 59037 ( 1.48%) trimmed reads available after processing 3940392 (98.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 12 0.00% 21 0 0.00% 22 2 0.00% 23 0 0.00% 24 3 0.00% 25 5 0.00% 26 5 0.00% 27 1 0.00% 28 10 0.00% 29 9 0.00% 30 12 0.00% 31 14 0.00% 32 31 0.00% 33 28 0.00% 34 30 0.00% 35 37 0.00% 36 41 0.00% 37 45 0.00% 38 65 0.00% 39 79 0.00% 40 93 0.00% 41 128 0.00% 42 152 0.00% 43 178 0.00% 44 246 0.01% 45 370 0.01% 46 534 0.01% 47 783 0.02% 48 1313 0.03% 49 2462 0.06% 50 6555 0.16% 51 45781 1.14% 52 3940392 98.52% 3999429 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.66 fanout-score-rank=18 prefix-density=0.21 prefix-fanout=1.9 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=192.39 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=10.1 sequence=CCTCCTCCTTTACGTGCAGATGATGAGGATGGTGGTGGGGATGGTGGCGCAGGAGATAATGGGGTTATTTTTTCATTACCAAATCGAGCATCTTGGATTACAGGATTTGATACCCTACATGGTGGTGATCCACAGTAAAATGGTGGTGATGATGCCACCTGGAAACCGGGTTTGTCCCCACCATAACCTCCCTTAGTAAGAATTATGTCTAGCAGCTCTGCCCCGGCTTTCGAATCTGCCATCTCCGCATGGTGATTGACAGGCAATCTTAGAGGTCTGATTTGTTCATTAAGAGGAGGATTTAAAAGTCCCAATCTCCTTGGCTTCGGACAAACCACAGACTCCACCACCACC Started job on | Feb 13 14:55:13 Started mapping on | Feb 13 14:55:13 Finished on | Feb 13 14:55:18 Mapping speed, Million of reads per hour | 2879.59 Number of input reads | 3999429 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3618421 Uniquely mapped reads % | 90.47% Average mapped length | 51.82 Number of splices: Total | 460991 Number of splices: Annotated (sjdb) | 451791 Number of splices: GT/AG | 453607 Number of splices: GC/AG | 6332 Number of splices: AT/AC | 386 Number of splices: Non-canonical | 666 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275344 % of reads mapped to multiple loci | 6.88% Number of reads mapped to too many loci | 67407 % of reads mapped to too many loci | 1.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105664 105664 105664 N_multimapping 275344 275344 275344 N_noFeature 131378 3587200 148307 N_ambiguous 25181 47 10868 UnstrandedReadsAssigned:3461862 PositiveStrandReadsAssigned:31174 NegativeStrandReadsAssigned:3459246 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423573 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423573-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,429 reads, 3,647,966 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR5423573.ke.tsv 34699 SRR5423573.se.tsv 87100 total ==> SRR5423573.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 294 47.1209 Potri.005G024800.1.v4.1 1035 936 127.049 41.7481 Potri.004G059700.1.v4.1 961 862 1 0.356808 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 55.599 6.01282 Potri.016G087400.1.v4.1 270 171 137 246.414 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 22.6842 4.16783 Potri.012G127500.1.v4.1 977 878 2705 947.576 ==> SRR5423573.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 6 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 16 SRR5423573 completed mapping pipeline successfully