Starting /dee2/code/volunteer_pipeline.sh SRR5423574 current disk space = 3089251950592 free memory = 1477693708 SRR5423574 SRAfilesize 8c56469ddfabfd057110ec7a6ae63eee SRR5423574.sra SRR5423574.sra file validated SRR5423574 is single end SRR5423574 is conventional basespace SRR5423574 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423574_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 27.56625 33.0 32.0 34.0 2.0 34.0 2 31.54275 33.0 31.0 34.0 27.0 34.0 3 31.73825 33.0 32.0 34.0 27.0 34.0 4 31.32625 33.0 32.0 34.0 27.0 34.0 5 32.1265 33.0 32.0 34.0 30.0 34.0 6 35.26375 38.0 36.0 38.0 29.0 38.0 7 35.82975 38.0 36.0 38.0 31.0 38.0 8 35.9635 38.0 37.0 38.0 31.0 38.0 9 36.0055 38.0 37.0 38.0 31.0 38.0 10 36.156 38.0 37.0 38.0 33.0 38.0 11 36.29 38.0 37.0 38.0 33.0 38.0 12 36.1905 38.0 37.0 38.0 33.0 38.0 13 36.007 38.0 37.0 38.0 31.0 38.0 14 35.895 38.0 37.0 38.0 31.0 38.0 15 35.60525 38.0 36.0 38.0 29.0 38.0 16 36.045 38.0 37.0 38.0 31.0 38.0 17 36.24875 38.0 37.0 38.0 33.0 38.0 18 35.8945 38.0 37.0 38.0 31.0 38.0 19 35.86475 38.0 37.0 38.0 31.0 38.0 20 36.218 38.0 37.0 38.0 33.0 38.0 21 36.37425 38.0 37.0 38.0 34.0 38.0 22 36.40775 38.0 37.0 38.0 34.0 38.0 23 36.1375 38.0 37.0 38.0 33.0 38.0 24 36.30725 38.0 37.0 38.0 33.0 38.0 25 36.20825 38.0 37.0 38.0 33.0 38.0 26 36.2775 38.0 37.0 38.0 33.0 38.0 27 36.31975 38.0 37.0 38.0 33.0 38.0 28 36.18275 38.0 37.0 38.0 33.0 38.0 29 36.45975 38.0 37.0 38.0 34.0 38.0 30 36.29725 38.0 37.0 38.0 33.0 38.0 31 36.41075 38.0 38.0 38.0 33.0 38.0 32 36.412 38.0 38.0 38.0 33.0 38.0 33 36.18475 38.0 37.0 38.0 33.0 38.0 34 36.33325 38.0 37.0 38.0 33.0 38.0 35 36.09075 38.0 37.0 38.0 33.0 38.0 36 36.1155 38.0 37.0 38.0 31.0 38.0 37 36.177 38.0 37.0 38.0 33.0 38.0 38 36.3485 38.0 37.0 38.0 33.0 38.0 39 36.40175 38.0 38.0 38.0 33.0 38.0 40 36.328 38.0 37.0 38.0 33.0 38.0 41 36.2095 38.0 37.0 38.0 33.0 38.0 42 36.26275 38.0 37.0 38.0 33.0 38.0 43 36.33875 38.0 38.0 38.0 33.0 38.0 44 36.55725 38.0 38.0 38.0 34.0 38.0 45 36.31725 38.0 37.0 38.0 33.0 38.0 46 36.39925 38.0 38.0 38.0 34.0 38.0 47 36.49175 38.0 38.0 38.0 34.0 38.0 48 36.38125 38.0 38.0 38.0 33.0 38.0 49 36.373 38.0 38.0 38.0 34.0 38.0 50 36.45875 38.0 38.0 38.0 34.0 38.0 51 36.324 38.0 38.0 38.0 33.0 38.0 52 35.92225 38.0 37.0 38.0 31.0 38.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2209 1 0.0 2209 2 0.0 2209 3 0.0 2209 4 0.0 2209 5 0.0 2209 6 0.0 2209 7 0.0 2209 8 0.0 2209 9 0.0 2209 10 0.0 2209 11 0.0 2209 12 0.0 2209 13 0.0 2209 14 0.0 2209 15 0.0 2209 16 0.0 2209 17 0.0 2209 18 0.0 2209 19 0.0 2209 20 0.0 2209 21 0.0 2209 22 0.0 2209 23 0.0 2209 24 0.0 2209 25 0.0 2209 26 0.0 2209 27 0.0 2209 28 0.0 2209 29 0.0 2209 30 0.0 2209 31 0.0 2209 32 0.0 2209 33 0.0 2209 34 0.0 2209 35 0.0 2209 36 0.0 2209 37 0.0 2209 38 0.0 2209 39 0.0 2209 40 0.0 2209 41 0.0 2209 42 0.0 2209 43 0.0 2209 44 0.0 2209 45 0.0 2209 46 0.0 2209 47 0.0 2209 48 0.0 2209 49 0.0 2209 50 0.0 2209 51 0.0 2209 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 11.0 26 16.0 27 25.0 28 41.0 29 68.0 30 97.0 31 114.0 32 147.0 33 222.0 34 273.0 35 443.0 36 963.0 37 1576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.83883437407077 11.269699672911091 7.314897413024085 47.57656853999405 2 20.275000000000002 15.299999999999999 37.8 26.625 3 20.45 17.375 25.05 37.125 4 24.0 25.7 22.925 27.375 5 22.900000000000002 29.099999999999998 25.874999999999996 22.125 6 18.325 33.0 26.150000000000002 22.525000000000002 7 13.675 23.1 43.325 19.900000000000002 8 16.625 21.349999999999998 32.625 29.4 9 18.025 20.7 35.125 26.150000000000002 10 17.5 35.975 26.0 20.525 11 22.875 27.425 23.025000000000002 26.674999999999997 12 22.675 22.225 27.1 28.000000000000004 13 19.825 26.150000000000002 27.625 26.400000000000002 14 19.45 26.474999999999998 27.175 26.900000000000002 15 20.1 25.575 28.050000000000004 26.275 16 20.95 25.724999999999998 27.250000000000004 26.075 17 21.325 25.374999999999996 26.575 26.724999999999998 18 20.724999999999998 25.8 26.0 27.474999999999998 19 21.175 27.250000000000004 25.525 26.05 20 20.349999999999998 26.375 27.3 25.974999999999998 21 20.424999999999997 24.8 27.175 27.6 22 19.950000000000003 25.75 27.3 27.0 23 21.025 24.9 27.650000000000002 26.424999999999997 24 20.349999999999998 24.95 27.224999999999998 27.474999999999998 25 19.650000000000002 25.7 26.6 28.050000000000004 26 20.849999999999998 25.474999999999998 27.500000000000004 26.174999999999997 27 19.675 26.575 27.250000000000004 26.5 28 21.6 24.4 27.975 26.025 29 21.175 24.4 27.85 26.575 30 20.525 24.85 27.6 27.025 31 20.549999999999997 26.674999999999997 27.875 24.9 32 21.3 25.4 26.575 26.724999999999998 33 20.05 25.15 28.475 26.325 34 20.925 25.874999999999996 26.474999999999998 26.724999999999998 35 21.75 25.55 27.025 25.674999999999997 36 20.599999999999998 25.4 26.424999999999997 27.575 37 20.75 25.85 27.474999999999998 25.924999999999997 38 21.349999999999998 25.45 27.400000000000002 25.8 39 21.025 25.224999999999998 26.400000000000002 27.35 40 21.125 25.424999999999997 27.800000000000004 25.650000000000002 41 19.425 25.650000000000002 27.975 26.950000000000003 42 20.65 25.575 26.8 26.974999999999998 43 20.95 25.900000000000002 27.175 25.974999999999998 44 21.425 26.6 26.8 25.174999999999997 45 21.5 25.3 27.125 26.075 46 20.325 25.424999999999997 27.474999999999998 26.775 47 20.225 24.224999999999998 27.55 28.000000000000004 48 20.599999999999998 25.3 28.000000000000004 26.1 49 20.424999999999997 26.125 27.55 25.900000000000002 50 20.875 24.95 26.650000000000002 27.525 51 20.8 24.6 27.175 27.425 52 20.455113778444613 24.306076519129782 28.532133033258315 26.70667666916729 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 3.0 23 5.0 24 6.0 25 7.0 26 12.5 27 18.0 28 26.0 29 34.0 30 41.5 31 49.0 32 59.5 33 70.0 34 83.5 35 97.0 36 126.5 37 156.0 38 180.0 39 220.0 40 236.0 41 261.5 42 287.0 43 316.5 44 346.0 45 355.0 46 364.0 47 395.0 48 426.0 49 413.5 50 401.0 51 382.0 52 363.0 53 322.5 54 282.0 55 245.5 56 209.0 57 184.5 58 160.0 59 140.5 60 121.0 61 97.0 62 73.0 63 53.5 64 28.5 65 23.0 66 19.0 67 15.0 68 10.0 69 5.0 70 6.0 71 7.0 72 3.5 73 0.0 74 2.5 75 5.0 76 2.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 15.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630396 spots for SRR5423574.sra Written 1630396 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra Read 1630383 spots for SRR5423574.sra Written 1630383 spots for SRR5423574.sra SRR ids: ['SRR5423574.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_elw_zong SRR5423574.sra spots: 32607673 blocks: [[1, 1630383], [1630384, 3260766], [3260767, 4891149], [4891150, 6521532], [6521533, 8151915], [8151916, 9782298], [9782299, 11412681], [11412682, 13043064], [13043065, 14673447], [14673448, 16303830], [16303831, 17934213], [17934214, 19564596], [19564597, 21194979], [21194980, 22825362], [22825363, 24455745], [24455746, 26086128], [26086129, 27716511], [27716512, 29346894], [29346895, 30977277], [30977278, 32607673]] SRR5423574 file size 5672904 SRR5423574 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423574 SRR5423574_1.fastq Input file: SRR5423574_1.fastq trimmed: SRR5423574-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:01:56 2025 >> started Thu Feb 13 15:02:11 2025 >> done (14.952s) 32607673 reads processed; of these: 2415 ( 0.01%) short reads filtered out after trimming by size control 3868 ( 0.01%) empty reads filtered out after trimming by size control 32601390 (99.98%) reads available; of these: 2661 ( 0.01%) trimmed reads available after processing 32598729 (99.99%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 60 0.00% 19 74 0.00% 20 59 0.00% 21 0 0.00% 22 0 0.00% 23 0 0.00% 24 0 0.00% 25 0 0.00% 26 0 0.00% 27 0 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 0 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 0 0.00% 51 2468 0.01% 52 32598729 99.99% 32601390 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.28 prefix-fanout=1.0 sequence=TACCCACCTTGTGTCTCACCCTTGCGCTCATCTTTCTTGCCTCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=19 fanout-score=77.63 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.2 sequence=CCACCACCACCAT Started job on | Feb 13 15:02:24 Started mapping on | Feb 13 15:02:25 Finished on | Feb 13 15:02:57 Mapping speed, Million of reads per hour | 3667.66 Number of input reads | 32601390 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 29442621 Uniquely mapped reads % | 90.31% Average mapped length | 51.82 Number of splices: Total | 3764917 Number of splices: Annotated (sjdb) | 3691743 Number of splices: GT/AG | 3705067 Number of splices: GC/AG | 52261 Number of splices: AT/AC | 3309 Number of splices: Non-canonical | 4280 Mismatch rate per base, % | 0.53% Deletion rate per base | 0.01% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2226690 % of reads mapped to multiple loci | 6.83% Number of reads mapped to too many loci | 572189 % of reads mapped to too many loci | 1.76% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.10% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 932079 932079 932079 N_multimapping 2226690 2226690 2226690 N_noFeature 1075473 29197242 1201151 N_ambiguous 207571 397 87691 UnstrandedReadsAssigned:28159577 PositiveStrandReadsAssigned:244982 NegativeStrandReadsAssigned:28153779 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423574 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423574-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,601,390 reads, 28,671,638 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,340 rounds 52401 SRR5423574.ke.tsv 34699 SRR5423574.se.tsv 87100 total ==> SRR5423574.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 2368.4 48.2112 Potri.005G024800.1.v4.1 1035 936 1126.59 47.0174 Potri.004G059700.1.v4.1 961 862 6.08009 0.275531 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 470.85 6.46727 Potri.016G087400.1.v4.1 270 171 1174 268.188 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 155.069 3.61857 Potri.012G127500.1.v4.1 977 878 20816 926.126 ==> SRR5423574.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 39 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 906 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 148 SRR5423574 completed mapping pipeline successfully