Starting /dee2/code/volunteer_pipeline.sh SRR5423575 current disk space = 3089227653120 free memory = 1516429608 SRR5423575 SRAfilesize 015fd811d8864d76db5829308ba41177 SRR5423575.sra SRR5423575.sra file validated SRR5423575 is single end SRR5423575 is conventional basespace SRR5423575 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423575_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.1945 34.0 31.0 34.0 30.0 34.0 2 32.40875 34.0 31.0 34.0 30.0 34.0 3 32.39975 34.0 31.0 34.0 30.0 34.0 4 35.43075 37.0 35.0 37.0 33.0 37.0 5 35.78125 37.0 35.0 37.0 35.0 37.0 6 35.78175 37.0 35.0 37.0 35.0 37.0 7 35.8135 37.0 35.0 37.0 35.0 37.0 8 35.898 37.0 35.0 37.0 35.0 37.0 9 37.67925 39.0 37.0 39.0 35.0 39.0 10 37.44475 39.0 37.0 39.0 34.0 39.0 11 37.567 39.0 37.0 39.0 35.0 39.0 12 37.574 39.0 37.0 39.0 35.0 39.0 13 37.6125 39.0 37.0 39.0 35.0 39.0 14 39.00475 40.0 38.0 41.0 36.0 41.0 15 38.9265 40.0 38.0 41.0 35.0 41.0 16 38.83775 40.0 38.0 41.0 35.0 41.0 17 38.823 40.0 38.0 41.0 35.0 41.0 18 38.7265 40.0 38.0 41.0 34.0 41.0 19 38.77075 40.0 38.0 41.0 34.0 41.0 20 38.778 40.0 38.0 41.0 34.0 41.0 21 38.642 40.0 38.0 41.0 34.0 41.0 22 38.60775 40.0 38.0 41.0 34.0 41.0 23 38.56525 40.0 38.0 41.0 34.0 41.0 24 38.69925 40.0 38.0 41.0 34.0 41.0 25 38.5985 40.0 38.0 41.0 34.0 41.0 26 38.61625 40.0 38.0 41.0 34.0 41.0 27 38.7385 40.0 38.0 41.0 34.0 41.0 28 38.63725 40.0 38.0 41.0 34.0 41.0 29 38.64725 40.0 38.0 41.0 34.0 41.0 30 38.4635 40.0 38.0 41.0 34.0 41.0 31 38.55875 40.0 38.0 41.0 34.0 41.0 32 38.63825 40.0 38.0 41.0 35.0 41.0 33 38.6975 40.0 38.0 41.0 35.0 41.0 34 38.4175 40.0 38.0 41.0 34.0 41.0 35 38.059 40.0 38.0 41.0 33.0 41.0 36 38.417 40.0 38.0 41.0 34.0 41.0 37 38.376 40.0 38.0 41.0 34.0 41.0 38 38.31275 40.0 38.0 41.0 33.0 41.0 39 38.12 40.0 38.0 41.0 33.0 41.0 40 38.09275 40.0 37.0 41.0 33.0 41.0 41 38.13175 40.0 38.0 41.0 33.0 41.0 42 38.034 40.0 37.0 41.0 33.0 41.0 43 37.98 40.0 37.0 41.0 33.0 41.0 44 38.00575 40.0 37.0 41.0 33.0 41.0 45 37.9195 40.0 37.0 41.0 33.0 41.0 46 37.9505 40.0 37.0 41.0 33.0 41.0 47 37.8825 40.0 37.0 41.0 33.0 41.0 48 37.58725 40.0 37.0 41.0 32.0 41.0 49 37.75075 40.0 37.0 41.0 33.0 41.0 50 37.553 40.0 37.0 41.0 32.0 41.0 51 37.49475 40.0 36.0 41.0 31.0 41.0 52 36.6385 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1112 1 0.0 1112 2 0.0 1112 3 0.0 1112 4 0.0 1112 5 0.0 1112 6 0.0 1112 7 0.0 1112 8 0.0 1112 9 0.0 1112 10 0.0 1112 11 0.0 1112 12 0.0 1112 13 0.0 1112 14 0.0 1112 15 0.0 1112 16 0.0 1112 17 0.0 1112 18 0.0 1112 19 0.0 1112 20 0.0 1112 21 0.0 1112 22 0.0 1112 23 0.0 1112 24 0.0 1112 25 0.0 1112 26 0.0 1112 27 0.0 1112 28 0.0 1112 29 0.0 1112 30 0.0 1112 31 0.0 1112 32 0.0 1112 33 0.0 1112 34 0.0 1112 35 0.0 1112 36 0.0 1112 37 0.0 1112 38 0.0 1112 39 0.0 1112 40 0.0 1112 41 0.0 1112 42 0.0 1112 43 0.0 1112 44 0.0 1112 45 0.0 1112 46 0.0 1112 47 0.0 1112 48 0.0 1112 49 0.0 1112 50 0.0 1112 51 0.0 1112 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 0.0 23 3.0 24 6.0 25 6.0 26 6.0 27 12.0 28 27.0 29 46.0 30 55.0 31 62.0 32 87.0 33 126.0 34 166.0 35 187.0 36 278.0 37 402.0 38 675.0 39 1842.0 40 11.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.75544976196442 11.701327987972938 6.539714357303934 46.003507892758705 2 22.400000000000002 14.274999999999999 37.175000000000004 26.150000000000002 3 22.05 17.025000000000002 23.7 37.225 4 24.275 26.424999999999997 21.475 27.825 5 22.525000000000002 31.4 25.025 21.05 6 18.475 31.075000000000003 26.05 24.4 7 14.174999999999999 23.599999999999998 42.725 19.5 8 16.675 22.175 32.525 28.625 9 17.8 21.275 33.7 27.224999999999998 10 18.125 34.625 26.150000000000002 21.099999999999998 11 22.275 26.450000000000003 22.175 29.099999999999998 12 20.4 23.5 26.900000000000002 29.2 13 19.225 26.325 27.725 26.724999999999998 14 20.1 26.200000000000003 27.250000000000004 26.450000000000003 15 20.4 24.7 27.725 27.175 16 20.225 25.15 26.05 28.575 17 19.45 27.375 27.075 26.1 18 21.425 24.725 26.900000000000002 26.950000000000003 19 20.575 26.950000000000003 26.724999999999998 25.75 20 20.125 25.224999999999998 27.35 27.3 21 19.900000000000002 25.224999999999998 27.0 27.875 22 20.424999999999997 25.1 27.525 26.950000000000003 23 22.175 24.825 27.825 25.174999999999997 24 21.4 24.325 25.8 28.475 25 20.5 25.724999999999998 26.85 26.924999999999997 26 19.8 26.8 27.05 26.35 27 20.875 24.975 26.724999999999998 27.425 28 19.35 25.624999999999996 28.825 26.200000000000003 29 20.849999999999998 24.05 29.025000000000002 26.075 30 20.825 23.875 28.7 26.6 31 21.3 25.174999999999997 27.900000000000002 25.624999999999996 32 19.625 25.05 28.749999999999996 26.575 33 20.974999999999998 24.474999999999998 27.35 27.200000000000003 34 21.275 25.374999999999996 25.674999999999997 27.675 35 19.85 25.0 28.525 26.625 36 20.075000000000003 25.0 27.825 27.1 37 20.925 24.675 26.974999999999998 27.425 38 21.725 26.3 26.150000000000002 25.825 39 21.125 25.05 26.3 27.525 40 20.45 25.8 26.224999999999998 27.525 41 19.875 25.3 27.625 27.200000000000003 42 19.975 25.3 26.474999999999998 28.249999999999996 43 20.775 26.224999999999998 27.075 25.924999999999997 44 21.349999999999998 25.55 26.474999999999998 26.625 45 21.15 24.125 27.0 27.725 46 20.7 24.75 26.1 28.449999999999996 47 19.925 25.3 27.3 27.474999999999998 48 21.5 25.025 26.724999999999998 26.75 49 20.8 24.25 27.250000000000004 27.700000000000003 50 20.275000000000002 25.374999999999996 28.199999999999996 26.150000000000002 51 20.974999999999998 24.9 26.575 27.55 52 20.375 25.7 25.324999999999996 28.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 5.5 23 9.0 24 11.0 25 13.0 26 16.0 27 19.0 28 22.0 29 25.0 30 30.0 31 35.0 32 48.5 33 62.0 34 79.0 35 96.0 36 109.5 37 123.0 38 150.5 39 197.0 40 216.0 41 260.0 42 304.0 43 336.5 44 369.0 45 351.5 46 334.0 47 364.0 48 394.0 49 401.0 50 408.0 51 382.0 52 356.0 53 322.0 54 288.0 55 255.0 56 222.0 57 198.5 58 175.0 59 154.0 60 133.0 61 115.5 62 98.0 63 72.0 64 42.5 65 39.0 66 31.5 67 24.0 68 19.0 69 14.0 70 9.5 71 5.0 72 4.0 73 3.0 74 3.5 75 4.0 76 2.5 77 1.0 78 1.5 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11616161616162 98.125 2 0.7575757575757576 1.5 3 0.12626262626262627 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra Read 200000 spots for SRR5423575.sra Written 200000 spots for SRR5423575.sra SRR ids: ['SRR5423575.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_pu7i9h98 SRR5423575.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423575 file size 703996 SRR5423575 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423575 SRR5423575_1.fastq Input file: SRR5423575_1.fastq trimmed: SRR5423575-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:02:02 2025 >> started Thu Feb 13 15:02:04 2025 >> done (1.949s) 4000000 reads processed; of these: 221 ( 0.01%) short reads filtered out after trimming by size control 391 ( 0.01%) empty reads filtered out after trimming by size control 3999388 (99.98%) reads available; of these: 58280 ( 1.46%) trimmed reads available after processing 3941108 (98.54%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 8 0.00% 20 8 0.00% 21 1 0.00% 22 0 0.00% 23 1 0.00% 24 1 0.00% 25 2 0.00% 26 2 0.00% 27 8 0.00% 28 12 0.00% 29 13 0.00% 30 11 0.00% 31 17 0.00% 32 10 0.00% 33 23 0.00% 34 26 0.00% 35 28 0.00% 36 31 0.00% 37 48 0.00% 38 53 0.00% 39 61 0.00% 40 93 0.00% 41 99 0.00% 42 149 0.00% 43 160 0.00% 44 236 0.01% 45 322 0.01% 46 491 0.01% 47 775 0.02% 48 1169 0.03% 49 2389 0.06% 50 6743 0.17% 51 45281 1.13% 52 3941108 98.54% 3999388 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.58 fanout-score-rank=7 prefix-density=0.25 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=79.98 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=12.0 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTT Started job on | Feb 13 15:02:18 Started mapping on | Feb 13 15:02:18 Finished on | Feb 13 15:02:23 Mapping speed, Million of reads per hour | 2879.56 Number of input reads | 3999388 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3617161 Uniquely mapped reads % | 90.44% Average mapped length | 51.82 Number of splices: Total | 459863 Number of splices: Annotated (sjdb) | 450734 Number of splices: GT/AG | 452519 Number of splices: GC/AG | 6329 Number of splices: AT/AC | 389 Number of splices: Non-canonical | 626 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276495 % of reads mapped to multiple loci | 6.91% Number of reads mapped to too many loci | 67622 % of reads mapped to too many loci | 1.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.95% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105732 105732 105732 N_multimapping 276495 276495 276495 N_noFeature 131643 3586279 148273 N_ambiguous 25337 57 11055 UnstrandedReadsAssigned:3460181 PositiveStrandReadsAssigned:30825 NegativeStrandReadsAssigned:3457833 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423575 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423575-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,388 reads, 3,647,168 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR5423575.ke.tsv 34699 SRR5423575.se.tsv 87100 total ==> SRR5423575.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 283 45.3295 Potri.005G024800.1.v4.1 1035 936 151 49.5873 Potri.004G059700.1.v4.1 961 862 1 0.356584 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 59.4188 6.4219 Potri.016G087400.1.v4.1 270 171 153 275.02 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 17.6043 3.23245 Potri.012G127500.1.v4.1 977 878 2468 864.012 ==> SRR5423575.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 98 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 23 SRR5423575 completed mapping pipeline successfully