Starting /dee2/code/volunteer_pipeline.sh SRR5423576 current disk space = 3089167327232 free memory = 1404951984 SRR5423576 SRAfilesize 0b54b4881d5637667c59f5fcf09701e3 SRR5423576.sra SRR5423576.sra file validated SRR5423576 is single end SRR5423576 is conventional basespace SRR5423576 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423576_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.49975 34.0 31.0 34.0 31.0 34.0 2 32.61775 34.0 31.0 34.0 31.0 34.0 3 32.71 34.0 31.0 34.0 31.0 34.0 4 36.0105 37.0 35.0 37.0 35.0 37.0 5 36.07925 37.0 35.0 37.0 35.0 37.0 6 35.99825 37.0 36.0 37.0 35.0 37.0 7 36.09125 37.0 36.0 37.0 35.0 37.0 8 36.09125 37.0 36.0 37.0 35.0 37.0 9 37.9215 39.0 38.0 39.0 35.0 39.0 10 37.68275 39.0 38.0 39.0 35.0 39.0 11 37.781 39.0 38.0 39.0 35.0 39.0 12 37.83425 39.0 38.0 39.0 35.0 39.0 13 37.7545 39.0 38.0 39.0 35.0 39.0 14 39.156 41.0 38.0 41.0 36.0 41.0 15 39.08375 40.0 39.0 41.0 36.0 41.0 16 39.108 40.0 39.0 41.0 36.0 41.0 17 39.1955 40.0 39.0 41.0 36.0 41.0 18 39.10925 40.0 39.0 41.0 36.0 41.0 19 39.0645 40.0 39.0 41.0 36.0 41.0 20 38.924 40.0 39.0 41.0 35.0 41.0 21 38.9735 40.0 39.0 41.0 35.0 41.0 22 39.14225 40.0 39.0 41.0 36.0 41.0 23 39.005 40.0 39.0 41.0 35.0 41.0 24 39.041 40.0 39.0 41.0 35.0 41.0 25 39.11675 40.0 39.0 41.0 36.0 41.0 26 38.89025 40.0 38.0 41.0 35.0 41.0 27 38.99225 40.0 39.0 41.0 35.0 41.0 28 38.865 40.0 38.0 41.0 35.0 41.0 29 38.823 40.0 38.0 41.0 35.0 41.0 30 38.83175 40.0 38.0 41.0 35.0 41.0 31 38.761 40.0 38.0 41.0 35.0 41.0 32 38.92675 40.0 38.0 41.0 35.0 41.0 33 38.8885 40.0 38.0 41.0 35.0 41.0 34 38.692 40.0 38.0 41.0 35.0 41.0 35 38.7115 40.0 38.0 41.0 35.0 41.0 36 38.6915 40.0 38.0 41.0 34.0 41.0 37 38.60675 40.0 38.0 41.0 34.0 41.0 38 38.39475 40.0 38.0 41.0 34.0 41.0 39 38.39575 40.0 38.0 41.0 34.0 41.0 40 38.4765 40.0 38.0 41.0 34.0 41.0 41 38.44375 40.0 38.0 41.0 34.0 41.0 42 38.42575 40.0 38.0 41.0 34.0 41.0 43 38.3495 40.0 38.0 41.0 34.0 41.0 44 38.19925 40.0 38.0 41.0 33.0 41.0 45 38.02025 40.0 38.0 41.0 33.0 41.0 46 38.076 40.0 37.0 41.0 33.0 41.0 47 38.096 40.0 37.0 41.0 33.0 41.0 48 37.837 40.0 37.0 41.0 33.0 41.0 49 37.8585 40.0 37.0 41.0 33.0 41.0 50 37.8115 40.0 37.0 41.0 33.0 41.0 51 37.79525 40.0 37.0 41.0 33.0 41.0 52 36.7945 39.0 35.0 40.0 31.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1207 1 0.0 1207 2 0.0 1207 3 0.0 1207 4 0.0 1207 5 0.0 1207 6 0.0 1207 7 0.0 1207 8 0.0 1207 9 0.0 1207 10 0.0 1207 11 0.0 1207 12 0.0 1207 13 0.0 1207 14 0.0 1207 15 0.0 1207 16 0.0 1207 17 0.0 1207 18 0.0 1207 19 0.0 1207 20 0.0 1207 21 0.0 1207 22 0.0 1207 23 0.0 1207 24 0.0 1207 25 0.0 1207 26 0.0 1207 27 0.0 1207 28 0.0 1207 29 0.0 1207 30 0.0 1207 31 0.0 1207 32 0.0 1207 33 0.0 1207 34 0.0 1207 35 0.0 1207 36 0.0 1207 37 0.0 1207 38 0.0 1207 39 0.0 1207 40 0.0 1207 41 0.0 1207 42 0.0 1207 43 0.0 1207 44 0.0 1207 45 0.0 1207 46 0.0 1207 47 0.0 1207 48 0.0 1207 49 0.0 1207 50 0.0 1207 51 0.0 1207 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.0 23 1.0 24 2.0 25 10.0 26 11.0 27 16.0 28 12.0 29 29.0 30 38.0 31 48.0 32 86.0 33 96.0 34 132.0 35 175.0 36 240.0 37 355.0 38 694.0 39 2033.0 40 15.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.855675269356055 10.974693059383613 6.715108995239288 46.45452267602105 2 21.099999999999998 13.975000000000001 37.05 27.875 3 20.075000000000003 17.05 25.974999999999998 36.9 4 24.85 25.4 22.825 26.924999999999997 5 25.124999999999996 31.45 23.825 19.6 6 18.95 33.074999999999996 24.7 23.275000000000002 7 14.249999999999998 22.1 43.0 20.65 8 17.4 21.875 31.924999999999997 28.799999999999997 9 17.224999999999998 21.2 34.475 27.1 10 18.2 35.15 25.825 20.825 11 22.475 25.924999999999997 24.825 26.775 12 21.5 21.425 28.749999999999996 28.325 13 19.5 25.424999999999997 28.325 26.75 14 20.474999999999998 25.275 28.175 26.075 15 20.674999999999997 25.4 28.075 25.85 16 22.2 26.1 26.875 24.825 17 20.200000000000003 25.924999999999997 27.725 26.150000000000002 18 21.125 25.25 27.400000000000002 26.224999999999998 19 20.175 27.825 26.900000000000002 25.1 20 20.5 25.4 29.049999999999997 25.05 21 21.349999999999998 25.85 27.125 25.674999999999997 22 21.525 25.8 27.575 25.1 23 20.75 25.95 26.875 26.424999999999997 24 20.025000000000002 24.875 28.1 27.0 25 21.15 25.4 27.125 26.325 26 20.8 26.224999999999998 26.900000000000002 26.075 27 21.65 25.374999999999996 26.55 26.424999999999997 28 19.425 26.35 28.799999999999997 25.424999999999997 29 20.225 26.450000000000003 27.175 26.150000000000002 30 20.5 25.35 27.675 26.474999999999998 31 19.950000000000003 26.125 27.325 26.6 32 21.575 25.074999999999996 27.325 26.025 33 20.375 25.124999999999996 27.725 26.775 34 21.2 24.425 26.1 28.275 35 21.425 25.775 25.7 27.1 36 20.5 25.3 27.35 26.85 37 20.575 26.224999999999998 25.900000000000002 27.3 38 21.375 26.275 26.775 25.575 39 20.599999999999998 24.7 27.075 27.625 40 20.549999999999997 26.400000000000002 26.775 26.275 41 20.775 24.775 28.050000000000004 26.400000000000002 42 20.0 25.775 27.400000000000002 26.825 43 21.15 26.05 26.025 26.775 44 21.775 25.324999999999996 25.5 27.400000000000002 45 19.475 25.75 26.85 27.925 46 21.425 25.4 26.400000000000002 26.775 47 20.65 24.625 27.55 27.175 48 20.855213803450862 24.60615153788447 27.25681420355089 27.28182045511378 49 20.78019504876219 24.831207801950487 27.781945486371594 26.60665166291573 50 20.925 25.874999999999996 26.674999999999997 26.525 51 20.80520130032508 24.281070267566893 27.481870467616904 27.431857964491122 52 20.155038759689923 26.056514128532132 27.306826706676667 26.481620405101275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 3.0 22 2.5 23 2.0 24 5.0 25 8.0 26 14.0 27 20.0 28 27.5 29 35.0 30 41.0 31 47.0 32 55.5 33 64.0 34 92.0 35 120.0 36 124.5 37 129.0 38 158.5 39 220.5 40 253.0 41 258.0 42 263.0 43 303.5 44 344.0 45 364.5 46 385.0 47 381.5 48 378.0 49 382.5 50 387.0 51 362.5 52 338.0 53 321.5 54 305.0 55 262.0 56 219.0 57 204.5 58 190.0 59 153.5 60 117.0 61 94.5 62 72.0 63 57.5 64 36.0 65 29.0 66 26.5 67 24.0 68 14.5 69 5.0 70 8.0 71 11.0 72 9.0 73 7.0 74 6.5 75 6.0 76 5.0 77 4.0 78 2.5 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.025 50 0.0 51 0.025 52 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14163090128756 98.175 2 0.7573844988639232 1.5 3 0.07573844988639232 0.22499999999999998 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.025 0.0 0.0 0.0 0.0 11 0.025 0.0 0.0 0.0 0.0 12 0.025 0.0 0.0 0.0 0.0 13 0.025 0.0 0.0 0.0 0.0 14 0.025 0.0 0.0 0.0 0.0 15 0.025 0.0 0.0 0.0 0.0 16 0.025 0.0 0.0 0.0 0.0 17 0.025 0.0 0.0 0.0 0.0 18 0.025 0.0 0.0 0.0 0.0 19 0.025 0.0 0.0 0.0 0.0 20 0.025 0.0 0.0 0.0 0.0 21 0.025 0.0 0.0 0.0 0.0 22 0.025 0.0 0.0 0.0 0.0 23 0.025 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra Read 200000 spots for SRR5423576.sra Written 200000 spots for SRR5423576.sra SRR ids: ['SRR5423576.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fvzc3s_r SRR5423576.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423576 file size 703968 SRR5423576 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423576 SRR5423576_1.fastq Input file: SRR5423576_1.fastq trimmed: SRR5423576-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:05:18 2025 >> started Thu Feb 13 15:05:20 2025 >> done (1.810s) 4000000 reads processed; of these: 227 ( 0.01%) short reads filtered out after trimming by size control 380 ( 0.01%) empty reads filtered out after trimming by size control 3999393 (99.98%) reads available; of these: 51594 ( 1.29%) trimmed reads available after processing 3947799 (98.71%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 10 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 3 0.00% 25 6 0.00% 26 2 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 13 0.00% 31 10 0.00% 32 14 0.00% 33 22 0.00% 34 22 0.00% 35 27 0.00% 36 29 0.00% 37 34 0.00% 38 41 0.00% 39 39 0.00% 40 69 0.00% 41 78 0.00% 42 95 0.00% 43 105 0.00% 44 167 0.00% 45 252 0.01% 46 369 0.01% 47 593 0.01% 48 871 0.02% 49 1793 0.04% 50 5813 0.15% 51 41079 1.03% 52 3947799 98.71% 3999393 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.56 fanout-score-rank=10 prefix-density=0.23 prefix-fanout=3.2 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=12.59 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.0 sequence=ATCAAATAAAGGCACACTACTATTCATTATTGATGTCTGTGATCAAATAACAAAGAGCGTGACGCGACCAAACCCATAGCCACCACCATCTAGTAACAGAACCATATCCTGCA Started job on | Feb 13 15:05:31 Started mapping on | Feb 13 15:05:32 Finished on | Feb 13 15:05:36 Mapping speed, Million of reads per hour | 3599.45 Number of input reads | 3999393 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3619365 Uniquely mapped reads % | 90.50% Average mapped length | 51.82 Number of splices: Total | 459969 Number of splices: Annotated (sjdb) | 450943 Number of splices: GT/AG | 452631 Number of splices: GC/AG | 6378 Number of splices: AT/AC | 334 Number of splices: Non-canonical | 626 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275752 % of reads mapped to multiple loci | 6.89% Number of reads mapped to too many loci | 67315 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104276 104276 104276 N_multimapping 275752 275752 275752 N_noFeature 131831 3588010 148530 N_ambiguous 25815 50 11129 UnstrandedReadsAssigned:3461719 PositiveStrandReadsAssigned:31305 NegativeStrandReadsAssigned:3459706 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423576 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423576-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,393 reads, 3,649,853 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,136 rounds 52401 SRR5423576.ke.tsv 34699 SRR5423576.se.tsv 87100 total ==> SRR5423576.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 287.187 45.9928 Potri.005G024800.1.v4.1 1035 936 131.049 43.0288 Potri.004G059700.1.v4.1 961 862 1 0.356528 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 56.4514 6.10023 Potri.016G087400.1.v4.1 270 171 155 278.571 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 23.4694 4.30871 Potri.012G127500.1.v4.1 977 878 2493 872.627 ==> SRR5423576.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 114 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 31 SRR5423576 completed mapping pipeline successfully