Starting /dee2/code/volunteer_pipeline.sh SRR5423577 current disk space = 3088829100032 free memory = 1582111204 SRR5423577 SRAfilesize 203bb38c24e9f8e9b5b194f6e00de5e9 SRR5423577.sra SRR5423577.sra file validated SRR5423577 is single end SRR5423577 is conventional basespace SRR5423577 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423577_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.794 34.0 31.0 34.0 31.0 34.0 2 32.87425 34.0 31.0 34.0 31.0 34.0 3 32.95575 34.0 33.0 34.0 31.0 34.0 4 36.2735 37.0 37.0 37.0 35.0 37.0 5 36.329 37.0 37.0 37.0 35.0 37.0 6 36.32125 37.0 37.0 37.0 35.0 37.0 7 36.27 37.0 37.0 37.0 35.0 37.0 8 36.2505 37.0 37.0 37.0 35.0 37.0 9 37.9845 39.0 38.0 39.0 35.0 39.0 10 38.0115 39.0 38.0 39.0 35.0 39.0 11 38.0425 39.0 38.0 39.0 35.0 39.0 12 38.011 39.0 38.0 39.0 35.0 39.0 13 38.07025 39.0 38.0 39.0 35.0 39.0 14 39.409 41.0 39.0 41.0 36.0 41.0 15 39.55975 41.0 40.0 41.0 37.0 41.0 16 39.51375 41.0 40.0 41.0 37.0 41.0 17 39.49025 41.0 39.0 41.0 36.0 41.0 18 39.425 41.0 39.0 41.0 36.0 41.0 19 39.5105 41.0 39.0 41.0 37.0 41.0 20 39.4885 41.0 39.0 41.0 37.0 41.0 21 39.51025 41.0 39.0 41.0 37.0 41.0 22 39.45125 41.0 39.0 41.0 37.0 41.0 23 39.28525 41.0 39.0 41.0 36.0 41.0 24 39.4075 41.0 39.0 41.0 36.0 41.0 25 39.388 41.0 39.0 41.0 36.0 41.0 26 39.383 41.0 39.0 41.0 36.0 41.0 27 39.36775 41.0 39.0 41.0 36.0 41.0 28 39.2845 41.0 39.0 41.0 36.0 41.0 29 39.13275 41.0 39.0 41.0 36.0 41.0 30 39.13625 41.0 39.0 41.0 36.0 41.0 31 39.1465 40.0 39.0 41.0 36.0 41.0 32 39.125 40.0 39.0 41.0 36.0 41.0 33 39.10725 40.0 39.0 41.0 36.0 41.0 34 39.1405 41.0 39.0 41.0 36.0 41.0 35 38.91125 40.0 39.0 41.0 35.0 41.0 36 38.88575 40.0 38.0 41.0 35.0 41.0 37 38.8835 40.0 38.0 41.0 35.0 41.0 38 38.696 40.0 38.0 41.0 35.0 41.0 39 38.739 40.0 38.0 41.0 35.0 41.0 40 38.667 40.0 38.0 41.0 35.0 41.0 41 38.57925 40.0 38.0 41.0 34.0 41.0 42 38.587 40.0 38.0 41.0 34.0 41.0 43 38.55325 40.0 38.0 41.0 34.0 41.0 44 38.57775 40.0 38.0 41.0 34.0 41.0 45 38.3505 40.0 38.0 41.0 34.0 41.0 46 38.2505 40.0 38.0 41.0 33.0 41.0 47 38.1795 40.0 38.0 41.0 33.0 41.0 48 38.11825 40.0 38.0 41.0 33.0 41.0 49 38.0855 40.0 38.0 41.0 33.0 41.0 50 38.074 40.0 38.0 41.0 33.0 41.0 51 37.92475 40.0 37.0 41.0 33.0 41.0 52 36.16175 38.0 35.0 40.0 29.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1301 1 0.0 1301 2 0.0 1301 3 0.0 1301 4 0.0 1301 5 0.0 1301 6 0.0 1301 7 0.0 1301 8 0.0 1301 9 0.0 1301 10 0.0 1301 11 0.0 1301 12 0.0 1301 13 0.0 1301 14 0.0 1301 15 0.0 1301 16 0.0 1301 17 0.0 1301 18 0.0 1301 19 0.0 1301 20 0.0 1301 21 0.0 1301 22 0.0 1301 23 0.0 1301 24 0.0 1301 25 0.0 1301 26 0.0 1301 27 0.0 1301 28 0.0 1301 29 0.0 1301 30 0.0 1301 31 0.0 1301 32 0.0 1301 33 0.0 1301 34 0.0 1301 35 0.0 1301 36 0.0 1301 37 0.0 1301 38 0.0 1301 39 0.0 1301 40 0.0 1301 41 0.0 1301 42 0.0 1301 43 0.0 1301 44 0.0 1301 45 0.0 1301 46 0.0 1301 47 0.0 1301 48 0.0 1301 49 0.0 1301 50 0.0 1301 51 0.0 1301 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 4.0 21 2.0 22 2.0 23 2.0 24 3.0 25 6.0 26 13.0 27 10.0 28 14.0 29 14.0 30 30.0 31 44.0 32 47.0 33 73.0 34 104.0 35 145.0 36 219.0 37 319.0 38 671.0 39 2262.0 40 14.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.07014028056113 11.397795591182366 6.638276553106212 46.893787575150306 2 21.6 14.000000000000002 37.175000000000004 27.224999999999998 3 22.175 16.475 24.125 37.225 4 25.074999999999996 25.924999999999997 20.549999999999997 28.449999999999996 5 23.95 29.975 24.325 21.75 6 17.925 32.375 25.7 24.0 7 14.149999999999999 22.425 43.025000000000006 20.4 8 18.0 22.7 31.75 27.55 9 18.075 19.45 35.775 26.700000000000003 10 18.975 34.599999999999994 25.5 20.925 11 23.400000000000002 26.700000000000003 22.375 27.525 12 21.45 22.55 27.625 28.375 13 21.575 25.174999999999997 28.225 25.025 14 21.45 24.6 28.1 25.85 15 20.925 24.825 27.3 26.950000000000003 16 22.15 26.575 26.674999999999997 24.6 17 20.825 26.400000000000002 27.150000000000002 25.624999999999996 18 21.6 25.7 26.0 26.700000000000003 19 21.525 25.15 27.05 26.275 20 21.825 25.025 27.700000000000003 25.45 21 21.4 25.25 26.650000000000002 26.700000000000003 22 21.349999999999998 25.825 27.400000000000002 25.424999999999997 23 20.525 26.825 26.724999999999998 25.924999999999997 24 21.7 24.325 27.650000000000002 26.325 25 19.975 25.074999999999996 26.625 28.325 26 19.45 26.724999999999998 27.500000000000004 26.325 27 19.925 25.025 27.700000000000003 27.35 28 20.45 25.7 27.200000000000003 26.650000000000002 29 21.875 24.725 27.025 26.375 30 20.75 24.075 27.900000000000002 27.275 31 20.4 25.95 27.0 26.650000000000002 32 20.9 25.374999999999996 26.700000000000003 27.025 33 20.7 24.575 28.349999999999998 26.375 34 22.15 25.324999999999996 25.124999999999996 27.400000000000002 35 22.175 24.95 26.85 26.025 36 21.425 24.925 27.175 26.474999999999998 37 21.925 25.275 25.974999999999998 26.825 38 20.925 25.374999999999996 26.924999999999997 26.775 39 20.424999999999997 26.35 26.224999999999998 27.0 40 20.599999999999998 25.924999999999997 26.075 27.400000000000002 41 21.175 25.674999999999997 26.650000000000002 26.5 42 22.075 24.975 26.0 26.950000000000003 43 20.225 25.525 27.450000000000003 26.8 44 20.424999999999997 24.9 28.075 26.6 45 21.175 23.375 27.925 27.525 46 21.55 24.875 25.674999999999997 27.900000000000002 47 20.9 26.525 26.0 26.575 48 20.255063765941486 24.781195298824706 27.406851712928233 27.556889222305575 49 20.349999999999998 25.5 26.55 27.6 50 21.575 25.525 26.400000000000002 26.5 51 20.200000000000003 24.575 27.325 27.900000000000002 52 21.0 25.174999999999997 27.3 26.525 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 3.5 21 5.0 22 4.0 23 3.0 24 4.0 25 5.0 26 10.5 27 16.0 28 20.0 29 24.0 30 35.5 31 47.0 32 53.5 33 60.0 34 75.5 35 91.0 36 113.5 37 136.0 38 154.0 39 190.5 40 209.0 41 248.0 42 287.0 43 312.0 44 337.0 45 328.5 46 320.0 47 378.5 48 437.0 49 407.5 50 378.0 51 368.5 52 359.0 53 340.0 54 321.0 55 287.0 56 253.0 57 219.5 58 186.0 59 159.0 60 132.0 61 102.0 62 72.0 63 63.5 64 41.0 65 27.0 66 25.5 67 24.0 68 18.5 69 13.0 70 11.0 71 9.0 72 7.0 73 5.0 74 3.5 75 2.0 76 3.0 77 4.0 78 4.0 79 4.0 80 3.0 81 2.0 82 1.0 83 0.0 84 0.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7330637007077857 1.4500000000000002 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCGGCTTTCCCTCCGATTGTGTACTGCCAAATCCTGATAGAGCCCGCAGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra Read 200000 spots for SRR5423577.sra Written 200000 spots for SRR5423577.sra SRR ids: ['SRR5423577.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p3yrtx88 SRR5423577.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423577 file size 704007 SRR5423577 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423577 SRR5423577_1.fastq Input file: SRR5423577_1.fastq trimmed: SRR5423577-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Thu Feb 13 15:42:22 2025 >> started Thu Feb 13 15:42:24 2025 >> done (2.659s) 4000000 reads processed; of these: 212 ( 0.01%) short reads filtered out after trimming by size control 333 ( 0.01%) empty reads filtered out after trimming by size control 3999455 (99.99%) reads available; of these: 55571 ( 1.39%) trimmed reads available after processing 3943884 (98.61%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 17 0.00% 20 9 0.00% 21 4 0.00% 22 0 0.00% 23 1 0.00% 24 5 0.00% 25 7 0.00% 26 10 0.00% 27 6 0.00% 28 5 0.00% 29 10 0.00% 30 10 0.00% 31 13 0.00% 32 22 0.00% 33 40 0.00% 34 29 0.00% 35 39 0.00% 36 47 0.00% 37 51 0.00% 38 55 0.00% 39 80 0.00% 40 80 0.00% 41 113 0.00% 42 115 0.00% 43 194 0.00% 44 240 0.01% 45 359 0.01% 46 550 0.01% 47 731 0.02% 48 1220 0.03% 49 2368 0.06% 50 6319 0.16% 51 42811 1.07% 52 3943884 98.61% 3999455 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=22 prefix-density=0.21 prefix-fanout=1.9 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=21 fanout-score=79.85 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.9 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTT Started job on | Feb 13 15:42:38 Started mapping on | Feb 13 15:42:39 Finished on | Feb 13 15:42:44 Mapping speed, Million of reads per hour | 2879.61 Number of input reads | 3999455 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3618998 Uniquely mapped reads % | 90.49% Average mapped length | 51.82 Number of splices: Total | 460725 Number of splices: Annotated (sjdb) | 451450 Number of splices: GT/AG | 453422 Number of splices: GC/AG | 6286 Number of splices: AT/AC | 375 Number of splices: Non-canonical | 642 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.39 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275380 % of reads mapped to multiple loci | 6.89% Number of reads mapped to too many loci | 67294 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105077 105077 105077 N_multimapping 275380 275380 275380 N_noFeature 131258 3587770 147920 N_ambiguous 25601 44 11012 UnstrandedReadsAssigned:3462139 PositiveStrandReadsAssigned:31184 NegativeStrandReadsAssigned:3460066 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423577 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423577-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,455 reads, 3,651,283 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,123 rounds 52401 SRR5423577.ke.tsv 34699 SRR5423577.se.tsv 87100 total ==> SRR5423577.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 285 45.5821 Potri.005G024800.1.v4.1 1035 936 134 43.9393 Potri.004G059700.1.v4.1 961 862 2 0.71211 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 60.4356 6.52211 Potri.016G087400.1.v4.1 270 171 143 256.664 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15 2.75018 Potri.012G127500.1.v4.1 977 878 2541 888.249 ==> SRR5423577.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 104 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR5423577 completed mapping pipeline successfully