Starting /dee2/code/volunteer_pipeline.sh SRR5423578 current disk space = 3051970236416 free memory = 1486250400 SRR5423578 SRAfilesize eec2dc2cd3d7662425d8a6d0bb6bb41b SRR5423578.sra SRR5423578.sra file validated SRR5423578 is single end SRR5423578 is conventional basespace SRR5423578 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423578_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.08 33.0 31.0 34.0 30.0 34.0 2 32.23375 34.0 31.0 34.0 30.0 34.0 3 32.3105 34.0 31.0 34.0 30.0 34.0 4 35.184 37.0 35.0 37.0 32.0 37.0 5 35.73725 37.0 35.0 37.0 33.0 37.0 6 35.765 37.0 35.0 37.0 33.0 37.0 7 35.95675 37.0 35.0 37.0 35.0 37.0 8 35.856 37.0 35.0 37.0 35.0 37.0 9 37.60475 39.0 37.0 39.0 35.0 39.0 10 37.546 39.0 37.0 39.0 35.0 39.0 11 37.465 39.0 37.0 39.0 35.0 39.0 12 37.55625 39.0 37.0 39.0 35.0 39.0 13 37.4655 39.0 37.0 39.0 35.0 39.0 14 38.726 40.0 38.0 41.0 34.0 41.0 15 38.7 40.0 38.0 41.0 34.0 41.0 16 38.7515 40.0 38.0 41.0 34.0 41.0 17 38.6845 40.0 38.0 41.0 35.0 41.0 18 38.77175 40.0 38.0 41.0 34.0 41.0 19 38.6505 40.0 38.0 41.0 34.0 41.0 20 38.73825 40.0 38.0 41.0 34.0 41.0 21 38.65225 40.0 38.0 41.0 34.0 41.0 22 38.62225 40.0 38.0 41.0 34.0 41.0 23 38.67175 40.0 38.0 41.0 34.0 41.0 24 38.72725 40.0 38.0 41.0 35.0 41.0 25 38.7045 40.0 38.0 41.0 35.0 41.0 26 38.64425 40.0 38.0 41.0 35.0 41.0 27 38.47575 40.0 38.0 41.0 34.0 41.0 28 38.56625 40.0 38.0 41.0 34.0 41.0 29 38.53525 40.0 38.0 41.0 34.0 41.0 30 38.49075 40.0 38.0 41.0 34.0 41.0 31 38.568 40.0 38.0 41.0 34.0 41.0 32 38.63575 40.0 38.0 41.0 35.0 41.0 33 38.2735 40.0 38.0 41.0 34.0 41.0 34 38.39475 40.0 38.0 41.0 34.0 41.0 35 38.27875 40.0 38.0 41.0 33.0 41.0 36 38.24475 40.0 38.0 41.0 33.0 41.0 37 38.34275 40.0 38.0 41.0 34.0 41.0 38 38.2495 40.0 38.0 41.0 34.0 41.0 39 38.30525 40.0 38.0 41.0 34.0 41.0 40 38.26375 40.0 38.0 41.0 33.0 41.0 41 37.96625 40.0 37.0 41.0 33.0 41.0 42 37.926 40.0 37.0 41.0 33.0 41.0 43 37.9045 40.0 37.0 41.0 33.0 41.0 44 37.84625 40.0 37.0 41.0 33.0 41.0 45 37.58 40.0 37.0 41.0 32.0 41.0 46 37.67525 40.0 37.0 41.0 32.0 41.0 47 37.68275 40.0 37.0 41.0 32.0 41.0 48 37.7295 40.0 37.0 41.0 33.0 41.0 49 37.74875 40.0 37.0 41.0 33.0 41.0 50 37.461 40.0 36.0 41.0 31.0 41.0 51 37.5465 40.0 37.0 41.0 32.0 41.0 52 36.76225 39.0 35.0 40.0 30.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 1312 1 0.0 1312 2 0.0 1312 3 0.0 1312 4 0.0 1312 5 0.0 1312 6 0.0 1312 7 0.0 1312 8 0.0 1312 9 0.0 1312 10 0.0 1312 11 0.0 1312 12 0.0 1312 13 0.0 1312 14 0.0 1312 15 0.0 1312 16 0.0 1312 17 0.0 1312 18 0.0 1312 19 0.0 1312 20 0.0 1312 21 0.0 1312 22 0.0 1312 23 0.0 1312 24 0.0 1312 25 0.0 1312 26 0.0 1312 27 0.0 1312 28 0.0 1312 29 0.0 1312 30 0.0 1312 31 0.0 1312 32 0.0 1312 33 0.0 1312 34 0.0 1312 35 0.0 1312 36 0.0 1312 37 0.0 1312 38 0.0 1312 39 0.0 1312 40 0.0 1312 41 0.0 1312 42 0.0 1312 43 0.0 1312 44 0.0 1312 45 0.0 1312 46 0.0 1312 47 0.0 1312 48 0.0 1312 49 0.0 1312 50 0.0 1312 51 0.0 1312 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 3.0 24 7.0 25 9.0 26 8.0 27 20.0 28 19.0 29 40.0 30 40.0 31 62.0 32 104.0 33 124.0 34 161.0 35 192.0 36 312.0 37 437.0 38 712.0 39 1737.0 40 9.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.48710242925119 11.119459053343352 6.811920861507638 46.58151765589782 2 20.674999999999997 14.75 37.0 27.575 3 20.525 17.075000000000003 25.55 36.85 4 23.849999999999998 25.85 22.3 28.000000000000004 5 23.974999999999998 29.799999999999997 24.375 21.85 6 18.2 33.925 24.55 23.325000000000003 7 15.174999999999999 22.475 43.075 19.275000000000002 8 16.475 22.1 32.65 28.775000000000002 9 18.099999999999998 20.225 34.150000000000006 27.525 10 17.95 36.225 25.35 20.474999999999998 11 24.0 26.325 22.3 27.375 12 20.575 21.475 28.575 29.375 13 18.875 27.3 27.825 26.0 14 20.125 25.650000000000002 28.15 26.075 15 19.650000000000002 25.275 27.450000000000003 27.625 16 20.974999999999998 25.775 26.75 26.5 17 20.825 26.674999999999997 26.1 26.400000000000002 18 20.625 25.25 26.875 27.250000000000004 19 20.125 26.3 27.125 26.450000000000003 20 19.3 26.1 27.650000000000002 26.950000000000003 21 20.125 26.575 27.250000000000004 26.05 22 21.224999999999998 26.650000000000002 26.35 25.775 23 21.025 25.95 27.425 25.6 24 21.15 25.7 27.025 26.125 25 20.65 24.7 27.175 27.474999999999998 26 18.95 27.125 27.875 26.05 27 20.0 25.4 27.275 27.325 28 18.6 26.35 27.975 27.075 29 20.9 26.775 26.924999999999997 25.4 30 20.925 25.874999999999996 27.925 25.275 31 21.05 25.85 26.650000000000002 26.450000000000003 32 19.6 25.674999999999997 27.250000000000004 27.474999999999998 33 21.8 24.525 26.974999999999998 26.700000000000003 34 19.775000000000002 26.025 26.375 27.825 35 22.0 25.174999999999997 26.775 26.05 36 19.900000000000002 25.624999999999996 27.275 27.200000000000003 37 20.150000000000002 25.7 27.05 27.1 38 21.525 24.625 27.725 26.125 39 21.75 24.3 26.75 27.200000000000003 40 21.025 25.374999999999996 26.775 26.825 41 21.25 26.474999999999998 26.5 25.775 42 20.65 24.349999999999998 28.15 26.85 43 21.7 24.825 26.75 26.724999999999998 44 20.275000000000002 24.575 27.6 27.55 45 20.724999999999998 25.15 27.875 26.25 46 21.025 25.5 27.05 26.424999999999997 47 21.175 25.025 27.675 26.125 48 21.50537634408602 24.006001500375092 27.506876719179797 26.981745436359088 49 21.475 25.074999999999996 25.825 27.625 50 21.05 24.5 27.800000000000004 26.650000000000002 51 21.15 25.1 26.825 26.924999999999997 52 20.8 25.874999999999996 26.25 27.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 3.0 19 5.0 20 4.0 21 3.0 22 4.0 23 5.0 24 9.5 25 14.0 26 15.0 27 16.0 28 20.5 29 25.0 30 35.0 31 45.0 32 55.0 33 65.0 34 77.5 35 90.0 36 120.0 37 150.0 38 178.0 39 223.5 40 241.0 41 261.0 42 281.0 43 306.5 44 332.0 45 356.0 46 380.0 47 371.5 48 363.0 49 367.0 50 371.0 51 362.0 52 353.0 53 325.0 54 297.0 55 266.5 56 236.0 57 208.5 58 181.0 59 149.0 60 117.0 61 97.0 62 77.0 63 65.0 64 44.5 65 36.0 66 28.0 67 20.0 68 19.5 69 19.0 70 12.5 71 6.0 72 3.5 73 1.0 74 2.5 75 4.0 76 4.5 77 5.0 78 3.0 79 1.0 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.025 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.06612821807168 98.125 2 0.9086320040383644 1.7999999999999998 3 0.025239777889954566 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra Read 200000 spots for SRR5423578.sra Written 200000 spots for SRR5423578.sra SRR ids: ['SRR5423578.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nyu4zy5k SRR5423578.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423578 file size 703955 SRR5423578 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423578 SRR5423578_1.fastq Input file: SRR5423578_1.fastq trimmed: SRR5423578-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 16:49:20 2025 >> started Wed Feb 12 16:49:22 2025 >> done (1.878s) 4000000 reads processed; of these: 235 ( 0.01%) short reads filtered out after trimming by size control 361 ( 0.01%) empty reads filtered out after trimming by size control 3999404 (99.99%) reads available; of these: 57590 ( 1.44%) trimmed reads available after processing 3941814 (98.56%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 12 0.00% 21 1 0.00% 22 4 0.00% 23 3 0.00% 24 2 0.00% 25 5 0.00% 26 10 0.00% 27 8 0.00% 28 1 0.00% 29 8 0.00% 30 9 0.00% 31 13 0.00% 32 20 0.00% 33 28 0.00% 34 37 0.00% 35 33 0.00% 36 28 0.00% 37 54 0.00% 38 56 0.00% 39 63 0.00% 40 81 0.00% 41 124 0.00% 42 128 0.00% 43 182 0.00% 44 275 0.01% 45 299 0.01% 46 421 0.01% 47 705 0.02% 48 1227 0.03% 49 2385 0.06% 50 6447 0.16% 51 44902 1.12% 52 3941814 98.56% 3999404 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.92 fanout-score-rank=14 prefix-density=0.23 prefix-fanout=2.0 sequence=GTCAACAAACCCTTCCTTGCGCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=77.06 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=11.8 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTTT Started job on | Feb 12 16:49:36 Started mapping on | Feb 12 16:49:36 Finished on | Feb 12 16:49:41 Mapping speed, Million of reads per hour | 2879.57 Number of input reads | 3999404 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3618023 Uniquely mapped reads % | 90.46% Average mapped length | 51.81 Number of splices: Total | 458895 Number of splices: Annotated (sjdb) | 449864 Number of splices: GT/AG | 451481 Number of splices: GC/AG | 6433 Number of splices: AT/AC | 348 Number of splices: Non-canonical | 633 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276709 % of reads mapped to multiple loci | 6.92% Number of reads mapped to too many loci | 66871 % of reads mapped to too many loci | 1.67% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.94% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104672 104672 104672 N_multimapping 276709 276709 276709 N_noFeature 131764 3586710 148458 N_ambiguous 25590 47 10954 UnstrandedReadsAssigned:3460669 PositiveStrandReadsAssigned:31266 NegativeStrandReadsAssigned:3458611 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423578 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423578-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,404 reads, 3,644,309 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,130 rounds 52401 SRR5423578.ke.tsv 34699 SRR5423578.se.tsv 87100 total ==> SRR5423578.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 273 43.8536 Potri.005G024800.1.v4.1 1035 936 142 46.766 Potri.004G059700.1.v4.1 961 862 1 0.35761 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 57.4358 6.22545 Potri.016G087400.1.v4.1 270 171 143.73 259.101 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.7902 2.9077 Potri.012G127500.1.v4.1 977 878 2561 899.151 ==> SRR5423578.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 97 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR5423578 completed mapping pipeline successfully