Starting /dee2/code/volunteer_pipeline.sh SRR5423579 current disk space = 3051913584640 free memory = 1442236892 SRR5423579 SRAfilesize 531f8043684720517f9950cd3f4fcc56 SRR5423579.sra SRR5423579.sra file validated SRR5423579 is single end SRR5423579 is conventional basespace SRR5423579 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423579_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 47 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.454 34.0 31.0 34.0 31.0 34.0 2 32.61025 34.0 31.0 34.0 31.0 34.0 3 32.7135 34.0 31.0 34.0 31.0 34.0 4 36.096 37.0 37.0 37.0 35.0 37.0 5 36.08575 37.0 37.0 37.0 35.0 37.0 6 36.12125 37.0 36.0 37.0 35.0 37.0 7 36.06875 37.0 36.0 37.0 35.0 37.0 8 35.872 37.0 35.0 37.0 35.0 37.0 9 37.91075 39.0 38.0 39.0 35.0 39.0 10 37.70975 39.0 38.0 39.0 35.0 39.0 11 37.7855 39.0 38.0 39.0 35.0 39.0 12 37.81125 39.0 38.0 39.0 35.0 39.0 13 37.78625 39.0 38.0 39.0 35.0 39.0 14 39.131 41.0 39.0 41.0 36.0 41.0 15 39.17875 41.0 39.0 41.0 36.0 41.0 16 39.1915 41.0 39.0 41.0 36.0 41.0 17 39.20325 40.0 39.0 41.0 36.0 41.0 18 39.14825 41.0 39.0 41.0 36.0 41.0 19 39.215 40.0 39.0 41.0 36.0 41.0 20 39.06825 40.0 39.0 41.0 35.0 41.0 21 39.06775 40.0 39.0 41.0 36.0 41.0 22 39.14975 40.0 39.0 41.0 36.0 41.0 23 39.17425 40.0 39.0 41.0 36.0 41.0 24 39.237 41.0 39.0 41.0 36.0 41.0 25 39.0245 40.0 39.0 41.0 36.0 41.0 26 39.09225 40.0 39.0 41.0 35.0 41.0 27 38.9765 40.0 39.0 41.0 35.0 41.0 28 39.20325 40.0 39.0 41.0 36.0 41.0 29 39.14175 40.0 39.0 41.0 36.0 41.0 30 39.0675 40.0 39.0 41.0 36.0 41.0 31 38.944 40.0 39.0 41.0 35.0 41.0 32 39.016 40.0 39.0 41.0 35.0 41.0 33 38.973 40.0 38.0 41.0 35.0 41.0 34 38.9915 40.0 39.0 41.0 35.0 41.0 35 38.79525 40.0 38.0 41.0 35.0 41.0 36 38.78875 40.0 38.0 41.0 35.0 41.0 37 38.76025 40.0 38.0 41.0 35.0 41.0 38 38.3045 40.0 38.0 41.0 33.0 41.0 39 38.526 40.0 38.0 41.0 34.0 41.0 40 38.281 40.0 38.0 41.0 34.0 41.0 41 38.43 40.0 38.0 41.0 34.0 41.0 42 38.46775 40.0 38.0 41.0 34.0 41.0 43 38.40075 40.0 38.0 41.0 34.0 41.0 44 38.2855 40.0 38.0 41.0 34.0 41.0 45 38.17925 40.0 38.0 41.0 33.0 41.0 46 38.1465 40.0 38.0 41.0 33.0 41.0 47 38.072 40.0 38.0 41.0 33.0 41.0 48 38.1955 40.0 38.0 41.0 33.0 41.0 49 38.253 40.0 38.0 41.0 33.0 41.0 50 38.2315 40.0 38.0 41.0 33.0 41.0 51 38.05325 40.0 37.0 41.0 33.0 41.0 52 37.34825 39.0 36.0 41.0 32.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2107 1 0.0 2107 2 0.0 2107 3 0.0 2107 4 0.0 2107 5 0.0 2107 6 0.0 2107 7 0.0 2107 8 0.0 2107 9 0.0 2107 10 0.0 2107 11 0.0 2107 12 0.0 2107 13 0.0 2107 14 0.0 2107 15 0.0 2107 16 0.0 2107 17 0.0 2107 18 0.0 2107 19 0.0 2107 20 0.0 2107 21 0.0 2107 22 0.0 2107 23 0.0 2107 24 0.0 2107 25 0.0 2107 26 0.0 2107 27 0.0 2107 28 0.0 2107 29 0.0 2107 30 0.0 2107 31 0.0 2107 32 0.0 2107 33 0.0 2107 34 0.0 2107 35 0.0 2107 36 0.0 2107 37 0.0 2107 38 0.0 2107 39 0.0 2107 40 0.0 2107 41 0.0 2107 42 0.0 2107 43 0.0 2107 44 0.0 2107 45 0.0 2107 46 0.0 2107 47 0.0 2107 48 0.0 2107 49 0.0 2107 50 0.0 2107 51 0.0 2107 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 0.0 20 0.0 21 0.0 22 1.0 23 4.0 24 5.0 25 0.0 26 8.0 27 15.0 28 18.0 29 31.0 30 31.0 31 58.0 32 70.0 33 84.0 34 109.0 35 169.0 36 220.0 37 393.0 38 664.0 39 2099.0 40 17.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.655224254572786 11.47582059634177 6.514657980456026 46.354297168629415 2 21.5 14.374999999999998 37.574999999999996 26.55 3 21.175 16.900000000000002 25.324999999999996 36.6 4 24.15 26.05 21.175 28.625 5 23.45 29.925 25.074999999999996 21.55 6 17.825 32.5 25.1 24.575 7 15.7 23.95 40.65 19.7 8 17.025000000000002 21.9 32.85 28.225 9 17.825 20.674999999999997 33.925 27.575 10 18.525 34.775 25.95 20.75 11 22.975 26.674999999999997 22.125 28.225 12 20.125 22.25 27.825 29.799999999999997 13 19.85 26.1 29.099999999999998 24.95 14 20.150000000000002 25.974999999999998 28.1 25.775 15 20.925 24.349999999999998 27.425 27.3 16 20.825 27.05 25.55 26.575 17 21.05 25.75 27.575 25.624999999999996 18 20.9 25.15 25.6 28.349999999999998 19 20.674999999999997 27.650000000000002 25.900000000000002 25.775 20 20.7 25.924999999999997 27.85 25.525 21 20.575 26.5 27.1 25.825 22 20.025000000000002 25.674999999999997 26.400000000000002 27.900000000000002 23 20.25 26.575 26.700000000000003 26.474999999999998 24 20.150000000000002 25.674999999999997 27.625 26.55 25 20.325 25.825 26.1 27.750000000000004 26 19.85 25.7 26.724999999999998 27.725 27 20.175 26.25 26.724999999999998 26.85 28 20.849999999999998 25.724999999999998 27.075 26.35 29 20.325 25.8 27.750000000000004 26.125 30 21.675 25.074999999999996 27.875 25.374999999999996 31 21.675 24.224999999999998 26.575 27.525 32 20.75 25.474999999999998 27.725 26.05 33 20.325 26.125 26.575 26.974999999999998 34 20.775 25.974999999999998 27.825 25.424999999999997 35 20.7 25.8 26.85 26.650000000000002 36 20.45 24.925 26.400000000000002 28.225 37 19.775000000000002 25.900000000000002 26.650000000000002 27.675 38 20.65 25.424999999999997 28.9 25.025 39 21.6 24.45 27.025 26.924999999999997 40 22.175 25.424999999999997 25.45 26.950000000000003 41 21.325 24.474999999999998 27.55 26.650000000000002 42 20.4 25.650000000000002 26.5 27.450000000000003 43 20.9 24.9 27.450000000000003 26.75 44 19.650000000000002 25.25 28.499999999999996 26.6 45 20.925 23.325000000000003 27.125 28.625 46 20.95 25.25 26.700000000000003 27.1 47 22.075 25.05 27.175 25.7 48 20.225 25.124999999999996 26.525 28.125 49 21.4 26.325 26.075 26.200000000000003 50 20.525 26.375 26.6 26.5 51 21.05 24.675 27.025 27.250000000000004 52 20.875 25.75 25.825 27.55 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 2.0 20 3.0 21 4.0 22 6.5 23 9.0 24 12.5 25 16.0 26 15.5 27 15.0 28 16.0 29 17.0 30 31.5 31 46.0 32 55.5 33 65.0 34 87.5 35 110.0 36 124.5 37 139.0 38 154.5 39 213.5 40 257.0 41 273.0 42 289.0 43 301.0 44 313.0 45 332.0 46 351.0 47 353.0 48 355.0 49 376.5 50 398.0 51 374.0 52 350.0 53 325.5 54 301.0 55 264.5 56 228.0 57 210.5 58 193.0 59 161.0 60 129.0 61 108.5 62 88.0 63 76.5 64 48.5 65 32.0 66 26.5 67 21.0 68 19.0 69 17.0 70 10.5 71 4.0 72 6.0 73 8.0 74 5.0 75 2.0 76 1.5 77 1.0 78 0.5 79 0.0 80 0.5 81 1.0 82 1.0 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7818411097099622 1.55 3 0.0 0.0 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGGATCAATCTCTGCTACATAATTAGCAGGCCTGTAATACCCAGTAACTG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.0 0.0 0.0 0.0 0.0 25 0.0 0.0 0.0 0.0 0.0 26 0.0 0.0 0.0 0.0 0.0 27 0.0 0.0 0.0 0.0 0.0 28 0.0 0.0 0.0 0.0 0.0 29 0.0 0.0 0.0 0.0 0.0 30 0.0 0.0 0.0 0.0 0.0 31 0.0 0.0 0.0 0.0 0.0 32 0.0 0.0 0.0 0.0 0.0 33 0.0 0.0 0.0 0.0 0.0 34 0.0 0.0 0.0 0.0 0.0 35 0.0 0.0 0.0 0.0 0.0 36 0.0 0.0 0.0 0.0 0.0 37 0.0 0.0 0.0 0.0 0.0 38 0.0 0.0 0.0 0.0 0.0 39 0.0 0.0 0.0 0.0 0.0 40 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra Read 200000 spots for SRR5423579.sra Written 200000 spots for SRR5423579.sra SRR ids: ['SRR5423579.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_80cl6lco SRR5423579.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423579 file size 703986 SRR5423579 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423579 SRR5423579_1.fastq Input file: SRR5423579_1.fastq trimmed: SRR5423579-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:04:33 2025 >> started Wed Feb 12 17:04:36 2025 >> done (3.203s) 4000000 reads processed; of these: 251 ( 0.01%) short reads filtered out after trimming by size control 389 ( 0.01%) empty reads filtered out after trimming by size control 3999360 (99.98%) reads available; of these: 50598 ( 1.27%) trimmed reads available after processing 3948762 (98.73%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 13 0.00% 20 7 0.00% 21 0 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 8 0.00% 26 4 0.00% 27 5 0.00% 28 5 0.00% 29 5 0.00% 30 3 0.00% 31 14 0.00% 32 15 0.00% 33 24 0.00% 34 24 0.00% 35 19 0.00% 36 34 0.00% 37 29 0.00% 38 33 0.00% 39 55 0.00% 40 71 0.00% 41 71 0.00% 42 80 0.00% 43 107 0.00% 44 202 0.01% 45 246 0.01% 46 377 0.01% 47 631 0.02% 48 954 0.02% 49 2002 0.05% 50 6034 0.15% 51 39517 0.99% 52 3948762 98.73% 3999360 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=9 prefix-density=0.24 prefix-fanout=3.1 sequence=CTTGTCCTTCATCTGGTCAACAAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=22 fanout-score=72.51 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.2 sequence=CCACCACCACCATCATCCTCTCCCTTTCCTCACAACCTCCTATCATGGCGCTCTTT Started job on | Feb 12 17:04:50 Started mapping on | Feb 12 17:04:50 Finished on | Feb 12 17:04:56 Mapping speed, Million of reads per hour | 2399.62 Number of input reads | 3999360 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3618721 Uniquely mapped reads % | 90.48% Average mapped length | 51.82 Number of splices: Total | 458324 Number of splices: Annotated (sjdb) | 449162 Number of splices: GT/AG | 450848 Number of splices: GC/AG | 6449 Number of splices: AT/AC | 419 Number of splices: Non-canonical | 608 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 1.66 Insertion rate per base | 0.00% Insertion average length | 1.41 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 276528 % of reads mapped to multiple loci | 6.91% Number of reads mapped to too many loci | 67139 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.92% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 104111 104111 104111 N_multimapping 276528 276528 276528 N_noFeature 132362 3587242 149190 N_ambiguous 25607 52 10927 UnstrandedReadsAssigned:3460752 PositiveStrandReadsAssigned:31427 NegativeStrandReadsAssigned:3458604 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423579 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423579-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,360 reads, 3,631,148 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,129 rounds 52401 SRR5423579.ke.tsv 34699 SRR5423579.se.tsv 87100 total ==> SRR5423579.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 269 43.306 Potri.005G024800.1.v4.1 1035 936 136 44.8884 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 49.8024 5.40993 Potri.016G087400.1.v4.1 270 171 147 265.578 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 24.5671 4.53387 Potri.012G127500.1.v4.1 977 878 2523 887.756 ==> SRR5423579.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 94 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 24 SRR5423579 completed mapping pipeline successfully