Starting /dee2/code/volunteer_pipeline.sh SRR5423580 current disk space = 3051906785280 free memory = 1487479716 SRR5423580 SRAfilesize f8e58c2472e7d05fb57a4a462b51988c SRR5423580.sra SRR5423580.sra file validated SRR5423580 is single end SRR5423580 is conventional basespace SRR5423580 read1 length is 52 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5423580_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 52 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8735 34.0 31.0 34.0 31.0 34.0 2 32.9875 34.0 33.0 34.0 31.0 34.0 3 33.07175 34.0 33.0 34.0 31.0 34.0 4 36.3225 37.0 37.0 37.0 35.0 37.0 5 36.311 37.0 37.0 37.0 35.0 37.0 6 36.29575 37.0 37.0 37.0 35.0 37.0 7 36.24975 37.0 37.0 37.0 35.0 37.0 8 36.28275 37.0 37.0 37.0 35.0 37.0 9 38.064 39.0 38.0 39.0 37.0 39.0 10 38.095 39.0 38.0 39.0 37.0 39.0 11 38.03425 39.0 38.0 39.0 35.0 39.0 12 38.0275 39.0 38.0 39.0 35.0 39.0 13 38.1265 39.0 39.0 39.0 37.0 39.0 14 39.542 41.0 40.0 41.0 37.0 41.0 15 39.60875 41.0 40.0 41.0 37.0 41.0 16 39.53825 41.0 40.0 41.0 37.0 41.0 17 39.46425 41.0 39.0 41.0 36.0 41.0 18 39.50225 41.0 39.0 41.0 37.0 41.0 19 39.5925 41.0 40.0 41.0 37.0 41.0 20 39.5305 41.0 40.0 41.0 37.0 41.0 21 39.4555 41.0 39.0 41.0 37.0 41.0 22 39.40625 41.0 39.0 41.0 36.0 41.0 23 39.40375 41.0 39.0 41.0 36.0 41.0 24 39.1685 41.0 39.0 41.0 36.0 41.0 25 39.0785 40.0 39.0 41.0 36.0 41.0 26 39.243 41.0 39.0 41.0 36.0 41.0 27 39.146 41.0 39.0 41.0 36.0 41.0 28 39.273 41.0 39.0 41.0 36.0 41.0 29 39.08425 40.0 39.0 41.0 36.0 41.0 30 39.208 40.0 39.0 41.0 36.0 41.0 31 39.13225 40.0 39.0 41.0 36.0 41.0 32 39.08325 41.0 39.0 41.0 36.0 41.0 33 39.01325 40.0 39.0 41.0 36.0 41.0 34 38.93 40.0 39.0 41.0 35.0 41.0 35 38.88525 40.0 39.0 41.0 35.0 41.0 36 38.81675 40.0 39.0 41.0 35.0 41.0 37 38.752 40.0 38.0 41.0 35.0 41.0 38 38.56575 40.0 38.0 41.0 34.0 41.0 39 38.7035 40.0 38.0 41.0 35.0 41.0 40 38.56125 40.0 38.0 41.0 35.0 41.0 41 38.40775 40.0 38.0 41.0 34.0 41.0 42 38.37975 40.0 38.0 41.0 34.0 41.0 43 38.2425 40.0 38.0 41.0 33.0 41.0 44 38.14425 40.0 38.0 41.0 33.0 41.0 45 38.2065 40.0 38.0 41.0 34.0 41.0 46 38.04725 40.0 38.0 41.0 33.0 41.0 47 37.8995 40.0 38.0 41.0 33.0 41.0 48 37.85775 40.0 37.0 41.0 33.0 41.0 49 37.914 40.0 38.0 41.0 33.0 41.0 50 37.90675 40.0 38.0 41.0 33.0 41.0 51 37.8325 40.0 37.0 41.0 33.0 41.0 52 36.20275 39.0 35.0 40.0 28.0 41.0 >>END_MODULE >>Per tile sequence quality pass #Tile Base Mean 2201 1 0.0 2201 2 0.0 2201 3 0.0 2201 4 0.0 2201 5 0.0 2201 6 0.0 2201 7 0.0 2201 8 0.0 2201 9 0.0 2201 10 0.0 2201 11 0.0 2201 12 0.0 2201 13 0.0 2201 14 0.0 2201 15 0.0 2201 16 0.0 2201 17 0.0 2201 18 0.0 2201 19 0.0 2201 20 0.0 2201 21 0.0 2201 22 0.0 2201 23 0.0 2201 24 0.0 2201 25 0.0 2201 26 0.0 2201 27 0.0 2201 28 0.0 2201 29 0.0 2201 30 0.0 2201 31 0.0 2201 32 0.0 2201 33 0.0 2201 34 0.0 2201 35 0.0 2201 36 0.0 2201 37 0.0 2201 38 0.0 2201 39 0.0 2201 40 0.0 2201 41 0.0 2201 42 0.0 2201 43 0.0 2201 44 0.0 2201 45 0.0 2201 46 0.0 2201 47 0.0 2201 48 0.0 2201 49 0.0 2201 50 0.0 2201 51 0.0 2201 52 0.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 0.0 22 3.0 23 2.0 24 9.0 25 5.0 26 8.0 27 22.0 28 22.0 29 20.0 30 30.0 31 46.0 32 65.0 33 67.0 34 91.0 35 155.0 36 197.0 37 316.0 38 706.0 39 2221.0 40 13.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.486486486486484 10.96096096096096 6.831831831831832 45.72072072072072 2 22.05 14.774999999999999 36.55 26.625 3 21.15 16.075 23.875 38.9 4 23.65 25.900000000000002 20.549999999999997 29.9 5 23.35 30.5 25.2 20.95 6 18.5 31.125000000000004 25.3 25.074999999999996 7 15.125 23.75 41.15 19.975 8 16.55 23.3 31.6 28.549999999999997 9 17.150000000000002 20.95 34.449999999999996 27.450000000000003 10 17.325 35.65 25.05 21.975 11 23.075000000000003 26.400000000000002 22.8 27.725 12 21.625 23.0 26.85 28.525 13 20.225 26.35 27.400000000000002 26.025 14 20.075000000000003 26.075 28.999999999999996 24.85 15 19.6 25.5 27.55 27.35 16 20.424999999999997 26.35 27.175 26.05 17 21.55 24.474999999999998 27.55 26.424999999999997 18 20.724999999999998 25.900000000000002 26.25 27.125 19 20.599999999999998 26.150000000000002 26.35 26.900000000000002 20 20.575 24.55 28.000000000000004 26.875 21 20.575 25.374999999999996 27.325 26.724999999999998 22 21.075 27.125 25.8 26.0 23 20.95 24.675 28.1 26.275 24 21.125 24.75 26.75 27.375 25 20.349999999999998 25.45 26.575 27.625 26 20.424999999999997 26.35 26.650000000000002 26.575 27 20.025000000000002 26.474999999999998 27.025 26.474999999999998 28 20.474999999999998 24.675 26.3 28.549999999999997 29 20.5 24.675 28.65 26.174999999999997 30 20.925 25.124999999999996 27.575 26.375 31 20.825 26.1 26.674999999999997 26.400000000000002 32 21.675 25.674999999999997 27.3 25.35 33 21.05 26.200000000000003 26.375 26.375 34 21.0 26.5 25.3 27.200000000000003 35 21.025 25.8 28.325 24.85 36 21.3 25.174999999999997 27.175 26.35 37 21.95 26.1 25.575 26.375 38 21.75 24.05 26.775 27.425 39 20.200000000000003 24.5 27.474999999999998 27.825 40 20.849999999999998 25.775 26.075 27.3 41 22.0 25.05 26.625 26.325 42 21.275 25.25 26.174999999999997 27.3 43 21.7 26.625 25.1 26.575 44 20.775 26.275 26.775 26.174999999999997 45 20.75 24.625 25.95 28.675 46 20.724999999999998 25.275 26.200000000000003 27.800000000000004 47 21.825 23.974999999999998 26.674999999999997 27.525 48 21.075 25.025 26.650000000000002 27.250000000000004 49 21.125 25.75 26.474999999999998 26.650000000000002 50 21.325 25.45 25.974999999999998 27.250000000000004 51 19.950000000000003 23.75 27.474999999999998 28.825 52 21.25 23.875 27.6 27.275 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 2.0 20 2.0 21 2.0 22 4.0 23 6.0 24 9.5 25 13.0 26 13.0 27 13.0 28 15.0 29 17.0 30 25.5 31 34.0 32 48.5 33 63.0 34 80.0 35 97.0 36 112.5 37 128.0 38 157.5 39 214.5 40 242.0 41 263.5 42 285.0 43 298.5 44 312.0 45 332.5 46 353.0 47 366.5 48 380.0 49 381.5 50 383.0 51 376.0 52 369.0 53 335.0 54 301.0 55 279.0 56 257.0 57 220.5 58 184.0 59 163.0 60 142.0 61 119.0 62 96.0 63 69.5 64 36.0 65 29.0 66 23.5 67 18.0 68 19.5 69 21.0 70 14.0 71 7.0 72 5.0 73 3.0 74 4.0 75 5.0 76 5.5 77 6.0 78 4.0 79 2.0 80 1.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 0.0 30 0.0 31 0.0 32 0.0 33 0.0 34 0.0 35 0.0 36 0.0 37 0.0 38 0.0 39 0.0 40 0.0 41 0.0 42 0.0 43 0.0 44 0.0 45 0.0 46 0.0 47 0.0 48 0.0 49 0.0 50 0.0 51 0.0 52 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 52 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21835602622289 98.375 2 0.7312153303076148 1.4500000000000002 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10 0.0 0.0 0.0 0.0 0.0 11 0.0 0.0 0.0 0.0 0.0 12 0.0 0.0 0.0 0.0 0.0 13 0.0 0.0 0.0 0.0 0.0 14 0.0 0.0 0.0 0.0 0.0 15 0.0 0.0 0.0 0.0 0.0 16 0.0 0.0 0.0 0.0 0.0 17 0.0 0.0 0.0 0.0 0.0 18 0.0 0.0 0.0 0.0 0.0 19 0.0 0.0 0.0 0.0 0.0 20 0.0 0.0 0.0 0.0 0.0 21 0.0 0.0 0.0 0.0 0.0 22 0.0 0.0 0.0 0.0 0.0 23 0.0 0.0 0.0 0.0 0.0 24 0.025 0.0 0.0 0.0 0.0 25 0.025 0.0 0.0 0.0 0.0 26 0.025 0.0 0.0 0.0 0.0 27 0.025 0.0 0.0 0.0 0.0 28 0.025 0.0 0.0 0.0 0.0 29 0.025 0.0 0.0 0.0 0.0 30 0.025 0.0 0.0 0.0 0.0 31 0.025 0.0 0.0 0.0 0.0 32 0.025 0.0 0.0 0.0 0.0 33 0.025 0.0 0.0 0.0 0.0 34 0.025 0.0 0.0 0.0 0.0 35 0.025 0.0 0.0 0.0 0.0 36 0.025 0.0 0.0 0.0 0.0 37 0.025 0.0 0.0 0.0 0.0 38 0.025 0.0 0.0 0.0 0.0 39 0.025 0.0 0.0 0.0 0.0 40 0.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra Read 200000 spots for SRR5423580.sra Written 200000 spots for SRR5423580.sra SRR ids: ['SRR5423580.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qot6sh1p SRR5423580.sra spots: 4000000 blocks: [[1, 200000], [200001, 400000], [400001, 600000], [600001, 800000], [800001, 1000000], [1000001, 1200000], [1200001, 1400000], [1400001, 1600000], [1600001, 1800000], [1800001, 2000000], [2000001, 2200000], [2200001, 2400000], [2400001, 2600000], [2600001, 2800000], [2800001, 3000000], [3000001, 3200000], [3200001, 3400000], [3400001, 3600000], [3600001, 3800000], [3800001, 4000000]] SRR5423580 file size 703950 SRR5423580 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5423580 SRR5423580_1.fastq Input file: SRR5423580_1.fastq trimmed: SRR5423580-trimmed.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- minimum overlap length for adapter detection (-k): inf -- number of concurrent threads (-t): 20 Wed Feb 12 17:09:29 2025 >> started Wed Feb 12 17:09:32 2025 >> done (2.115s) 4000000 reads processed; of these: 262 ( 0.01%) short reads filtered out after trimming by size control 370 ( 0.01%) empty reads filtered out after trimming by size control 3999368 (99.98%) reads available; of these: 59183 ( 1.48%) trimmed reads available after processing 3940185 (98.52%) untrimmed reads available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 14 0.00% 20 5 0.00% 21 1 0.00% 22 1 0.00% 23 4 0.00% 24 5 0.00% 25 4 0.00% 26 12 0.00% 27 16 0.00% 28 10 0.00% 29 16 0.00% 30 13 0.00% 31 18 0.00% 32 30 0.00% 33 43 0.00% 34 38 0.00% 35 49 0.00% 36 60 0.00% 37 67 0.00% 38 82 0.00% 39 114 0.00% 40 107 0.00% 41 141 0.00% 42 139 0.00% 43 256 0.01% 44 311 0.01% 45 469 0.01% 46 649 0.02% 47 934 0.02% 48 1465 0.04% 49 2773 0.07% 50 7044 0.18% 51 44284 1.11% 52 3940185 98.52% 3999368 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=1.93 fanout-score-rank=32 prefix-density=0.30 prefix-fanout=1.0 sequence=TACCCACCTTGTG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=11.63 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.0 sequence=ATCAAATAAAGGCACACTACTATTCATTATTGATGTCTGTGATCAAATAACAAAGAGCGTGACGCGACCAAACCCATAGCCACCACCATCTAGTAACAGAACCATATCCTGCA Started job on | Feb 12 17:09:45 Started mapping on | Feb 12 17:09:46 Finished on | Feb 12 17:09:51 Mapping speed, Million of reads per hour | 2879.54 Number of input reads | 3999368 Average input read length | 51 UNIQUE READS: Uniquely mapped reads number | 3617689 Uniquely mapped reads % | 90.46% Average mapped length | 51.82 Number of splices: Total | 458944 Number of splices: Annotated (sjdb) | 449813 Number of splices: GT/AG | 451611 Number of splices: GC/AG | 6345 Number of splices: AT/AC | 364 Number of splices: Non-canonical | 624 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.40 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 275871 % of reads mapped to multiple loci | 6.90% Number of reads mapped to too many loci | 67074 % of reads mapped to too many loci | 1.68% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.97% % of reads unmapped: other | 0.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 105808 105808 105808 N_multimapping 275871 275871 275871 N_noFeature 131121 3586418 147718 N_ambiguous 25605 68 10891 UnstrandedReadsAssigned:3460963 PositiveStrandReadsAssigned:31203 NegativeStrandReadsAssigned:3459080 Dataset is classified negative stranded MeadianReadLen=52 20thPercentileLength=52 echo kmer=47 SRR5423580 Starting Kallisto single end mapping to ensembl reference transcriptome. kmer=31 [quant] fragment length distribution is truncated gaussian with mean = 100, sd = 20 [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in single-end mode [quant] will process file 1: SRR5423580-trimmed.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 3,999,368 reads, 3,649,130 reads pseudoaligned [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52401 SRR5423580.ke.tsv 34699 SRR5423580.se.tsv 87100 total ==> SRR5423580.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1919 295 47.2737 Potri.005G024800.1.v4.1 1035 936 116.044 38.1259 Potri.004G059700.1.v4.1 961 862 0 0 Potri.007G009000.2.v4.1 1416 1317 0 0 Potri.003G141000.2.v4.1 2943 2844 73.1951 7.91452 Potri.016G087400.1.v4.1 270 171 158 284.141 Potri.015G069301.1.v4.1 564 465 0 0 Potri.010G195200.1.v4.1 1773 1674 15.9233 2.92516 Potri.012G127500.1.v4.1 977 878 2585 905.396 ==> SRR5423580.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 88 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 21 SRR5423580 completed mapping pipeline successfully